ID: 1200411647

View in Genome Browser
Species Human (GRCh38)
Location Y:2867663-2867685
Sequence CTCCACGCCTGGTTTGCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 450
Summary {0: 1, 1: 9, 2: 45, 3: 89, 4: 306}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200411647_1200411654 14 Left 1200411647 Y:2867663-2867685 CCAAGGGCAAACCAGGCGTGGAG 0: 1
1: 9
2: 45
3: 89
4: 306
Right 1200411654 Y:2867700-2867722 ATGTGAACAAGCATGAGGTCTGG 0: 1
1: 0
2: 6
3: 32
4: 205
1200411647_1200411653 9 Left 1200411647 Y:2867663-2867685 CCAAGGGCAAACCAGGCGTGGAG 0: 1
1: 9
2: 45
3: 89
4: 306
Right 1200411653 Y:2867695-2867717 GGGGTATGTGAACAAGCATGAGG 0: 1
1: 4
2: 27
3: 44
4: 215
1200411647_1200411652 -10 Left 1200411647 Y:2867663-2867685 CCAAGGGCAAACCAGGCGTGGAG 0: 1
1: 9
2: 45
3: 89
4: 306
Right 1200411652 Y:2867676-2867698 AGGCGTGGAGCAGTGAGGAGGGG 0: 1
1: 0
2: 4
3: 60
4: 615

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200411647 Original CRISPR CTCCACGCCTGGTTTGCCCT TGG (reversed) Intronic
901041582 1:6367442-6367464 CTCCACACCAGGCTTGTCCTTGG - Intronic
901399022 1:9003411-9003433 CTCCACAAATGTTTTGCCCTTGG + Exonic
902361250 1:15943727-15943749 CCCCACGCCAGGTTCGCCCTCGG - Intronic
902796360 1:18803227-18803249 CTCCATGCCTTCTGTGCCCTGGG - Intergenic
903014635 1:20353977-20353999 CTCCAGGCCCAGCTTGCCCTTGG - Exonic
903337363 1:22634161-22634183 TTCCATGCCTGACTTGCCCTGGG - Intergenic
903554279 1:24181714-24181736 GCCCAGGCCTGGTTTTCCCTGGG + Intronic
904370215 1:30043492-30043514 CTCCACGTCTGGCTTGCCCTTGG + Intergenic
904551897 1:31325628-31325650 CTCCGAGCCTGGCTCGCCCTTGG + Intronic
906082280 1:43101216-43101238 CTCCATGCCTGGCTCACCCTTGG - Intergenic
906132317 1:43468055-43468077 CTCCACACCTGGCTTGCCCTTGG - Intergenic
906854898 1:49293278-49293300 CTCCACGCCTGGCTTGCCCTTGG + Intronic
907985466 1:59525255-59525277 CTCCACGCCTGGGTCACCCTTGG + Intronic
911025170 1:93427884-93427906 CTCCATGCCTGGCTTGCCCTTGG + Intergenic
911267070 1:95754590-95754612 CTCAACGCCCTGCTTGCCCTTGG + Intergenic
911475304 1:98366471-98366493 CTCCATGCCTGGTTCTCTCTTGG - Intergenic
911935018 1:103959766-103959788 CTTCATGCCTGGCTTGCACTTGG - Intergenic
912943071 1:114061855-114061877 CTCCATGCCTGGCTCCCCCTTGG + Intergenic
915184979 1:154098010-154098032 CTCCATGCCTGGCTCACCCTTGG - Intronic
915403281 1:155639950-155639972 CACCATGCCTGGCTGGCCCTGGG - Intergenic
916966001 1:169944156-169944178 CTCCACACCTGGCTAACCCTTGG - Intronic
917848695 1:179042212-179042234 CTCTGCACCTGGCTTGCCCTTGG - Intronic
919168637 1:193927103-193927125 CTCCAAGCCTGGCTTGCCCTTGG - Intergenic
921097938 1:211902780-211902802 CTGCACACCTGGCTCGCCCTTGG + Intergenic
921675360 1:217969630-217969652 CTCCATGCCTGGCTCACCCTTGG + Intergenic
922141555 1:222893460-222893482 CTCCATGCCTGGCTTGCCTTTGG - Intronic
923917835 1:238529406-238529428 CTCCATGCCTGGCTCACCCTTGG - Intergenic
924421089 1:243910866-243910888 CTCCAGGCCTGCTGTCCCCTTGG - Intergenic
1064010450 10:11731016-11731038 CTTCACACCTGGATTGCCCTTGG + Intergenic
1065408324 10:25392334-25392356 CTCCACACTTGGCTTGCCCTTGG + Intronic
1065830484 10:29609826-29609848 CTCCATGCCTGGCTTGCCCTTGG + Intronic
1066508344 10:36067536-36067558 CTCCATGCCTGGCTTGCCCTTGG + Intergenic
1067018160 10:42772840-42772862 CTCCATGCCTGGCTTACCCTTGG + Intergenic
1067258515 10:44666195-44666217 CTCTGCTCCTGGCTTGCCCTTGG - Intergenic
1068083719 10:52348468-52348490 CTCCACACCTGATTTGCCCTTGG + Intergenic
1068157558 10:53221932-53221954 CTCCACACCTGGCTCACCCTTGG - Intergenic
1069121942 10:64577746-64577768 CTCCACACCTGGCTTGCCCTTGG + Intergenic
1069212625 10:65780219-65780241 CTCCATGCCTGGCTTGCCCATGG + Intergenic
1069575849 10:69528089-69528111 CTCCACACCTGATTGGCCCTTGG - Intergenic
1069958890 10:72068179-72068201 GTCCTCACCTGGTTTGCCATCGG + Exonic
1070401263 10:76055603-76055625 CTCCACACCTGGCTCACCCTTGG - Intronic
1071440948 10:85693842-85693864 ATCAATGTCTGGTTTGCCCTTGG - Intronic
1071819225 10:89263788-89263810 CTCTACACCTGGCTTGACCTTGG - Intronic
1073824440 10:107304312-107304334 CACCACGCCTGGCCTGCCATTGG - Intergenic
1074301679 10:112239503-112239525 CTCCATGCTTGGCTTGCCCTTGG - Intergenic
1075007977 10:118844020-118844042 TTCCACACCTGACTTGCCCTTGG + Intergenic
1075125346 10:119694776-119694798 CTCCACGCCTGGCTTGCCCTTGG - Intergenic
1075131958 10:119748082-119748104 CTCCGCACCTGGCTTGCCATTGG - Intronic
1075792659 10:125096008-125096030 CTCCCTTCCTGGTTTGCCTTTGG - Intronic
1076409019 10:130232713-130232735 CTGCAAGCCTGGACTGCCCTGGG - Intergenic
1077336774 11:2008786-2008808 CTCCACACCTGGATTTCCCCAGG - Intergenic
1078638752 11:13076445-13076467 CTCCTGGCCTGGTCTGCCTTAGG - Intergenic
1078641924 11:13104792-13104814 CTTCACTCCTGGTCTGCTCTTGG - Intergenic
1078859061 11:15230672-15230694 CTCTGTGCTTGGTTTGCCCTTGG - Intronic
1079183990 11:18220430-18220452 CTCTGTGCCTGGTTTGCCCTTGG - Intronic
1080208202 11:29755643-29755665 CTCCACACCTGGTTTGCCCTTGG - Intergenic
1081010873 11:37811541-37811563 CTCCACGCCTGGCTGGCTCTTGG - Intergenic
1081044001 11:38249846-38249868 CTCCACACCTGTCTTGCCCTTGG - Intergenic
1081268723 11:41058423-41058445 TTCCATGCCTGACTTGCCCTTGG + Intronic
1081578049 11:44332011-44332033 CACCACGCCTGGCTGGCCTTGGG + Intergenic
1081632682 11:44700574-44700596 CTCTACCCCTGGCTTGCACTAGG - Intergenic
1081767240 11:45620263-45620285 CTCTATGCCTGGCTTGCTCTTGG - Intergenic
1082687573 11:56259608-56259630 CTCTGCACCTGGCTTGCCCTTGG - Intergenic
1082749988 11:57005208-57005230 CTCCATGCCTGACTTGCCCTTGG - Intergenic
1083599792 11:63939474-63939496 CTCCAAGCCAGGGTTGACCTCGG - Intronic
1083674508 11:64318035-64318057 ACCCACGCCTCGTTTGCACTGGG - Exonic
1084093456 11:66894499-66894521 CTCCTCTCCTGTTCTGCCCTTGG - Intronic
1085334095 11:75678153-75678175 TTCCACGCCTGGCTCGCCCTTGG - Intergenic
1085497014 11:76979002-76979024 CTCCATTCCTGGCTTCCCCTTGG + Intronic
1086305325 11:85473153-85473175 CGGCACACCTGGCTTGCCCTTGG + Intronic
1086508173 11:87527859-87527881 CTCCATGCCTGGCTTACCCTTGG - Intergenic
1086946940 11:92853106-92853128 CTCCACGCCTGGCTCGCCCTTGG - Intronic
1087131501 11:94672820-94672842 CTCTGCACCTGGCTTGCCCTTGG + Intergenic
1089337451 11:117734886-117734908 CTCCGCCCCTGGCTTTCCCTGGG - Intronic
1089498020 11:118917639-118917661 CTCCATGCCTGATGTGCCCGGGG + Intronic
1089592020 11:119547727-119547749 TTCCACGCCTGACTTGCTCTTGG + Intergenic
1091283949 11:134397700-134397722 GGCCAGGCCTGGTTTGCGCTTGG - Intronic
1202819758 11_KI270721v1_random:63968-63990 CTCCACACCTGGATTTCCCCAGG - Intergenic
1091770912 12:3150782-3150804 CCCCACGCCTGGCCTGGCCTTGG + Intronic
1093182915 12:15987875-15987897 CTCCGCGCCTGGCTTGCCCTTGG - Intronic
1093492872 12:19725225-19725247 CTCCATGCCTGGCTTACCCTTGG - Intergenic
1093525573 12:20101301-20101323 CTCCATGCCTGGCTCACCCTTGG - Intergenic
1095042929 12:37464228-37464250 CTCAACTCCTGGCTTCCCCTTGG - Intergenic
1096294928 12:50375926-50375948 CTCCATGCCTGGCTCACCCTTGG - Intronic
1096295525 12:50380866-50380888 CTCCATGCCTGGCTCACCCTTGG - Intronic
1097446398 12:59678023-59678045 CTCCACACCTGGCTCACCCTTGG - Intronic
1098357752 12:69627280-69627302 CTCCAAGCCTGGTAAGCCCCAGG - Intergenic
1098951726 12:76646161-76646183 CTCCATGCCTGGCTTGGCCTTGG + Intergenic
1098956697 12:76695982-76696004 CTCCACCCCTGGTTAGTCCTGGG + Intergenic
1099683213 12:85855453-85855475 CTCCACACCTGGCTCACCCTTGG - Intergenic
1100672694 12:96834419-96834441 CTCCACACCTGACTTGCCCTTGG - Intronic
1100848037 12:98679878-98679900 TTCCACGCCTGACTCGCCCTTGG + Intronic
1101580768 12:106039395-106039417 CTTCATGCCTGGCTCGCCCTTGG - Intergenic
1101807133 12:108073846-108073868 CTCCCTGCCTGGTTTACCTTGGG + Intergenic
1102548453 12:113673786-113673808 CTCCAGGCCTGGTTATCTCTTGG + Intergenic
1103859567 12:124001513-124001535 CTCCACGCATGCCTTTCCCTCGG + Intronic
1104659915 12:130604016-130604038 CTCCACGCGTGCTTTGCCCCTGG + Intronic
1105837705 13:24225185-24225207 CTCCATTCCTGGTTTGCCCTTGG - Intronic
1106253383 13:28001149-28001171 CTCTGCGCCTGGCTCGCCCTTGG - Intergenic
1106489976 13:30212439-30212461 CTCTGTGCCTGGCTTGCCCTTGG + Intronic
1107770695 13:43786107-43786129 CTCCCCGCCTAGTCTGCGCTGGG - Intronic
1108542295 13:51455646-51455668 CTCCGCACCTGGCTTGCACTTGG - Intergenic
1108559229 13:51626932-51626954 CTCTGCACCTGGCTTGCCCTTGG - Intronic
1108848200 13:54699971-54699993 CTCCATGCCTGCCTTGCCCTTGG - Intergenic
1109426356 13:62169165-62169187 CTCCACACCTGGCTTGCCCTTGG + Intergenic
1109603709 13:64663985-64664007 CTCTACACCTGACTTGCCCTTGG + Intergenic
1109622098 13:64924594-64924616 CTCCACACCTGACTCGCCCTTGG - Intergenic
1109686770 13:65830635-65830657 CTCTGTGCCTGGTGTGCCCTTGG + Intergenic
1109780897 13:67108116-67108138 CTCCACACCTGGCTCACCCTTGG + Intronic
1109851934 13:68076263-68076285 CTCCATGCCTGGCTTGCCTTTGG + Intergenic
1109944787 13:69419846-69419868 CTCCATGCCTGGTTTGCCCTTGG - Intergenic
1109988232 13:70017546-70017568 CTCCACACCTGGATTGCCCTTGG + Intronic
1110014626 13:70385994-70386016 CTCCACACCTGGTTCACCCTCGG - Intergenic
1110343044 13:74414649-74414671 ATCCGAGCCTGGCTTGCCCTTGG + Intergenic
1110439002 13:75507224-75507246 CTCCACGCCTGGCTCACCCTGGG - Intergenic
1110810795 13:79808721-79808743 CTCCATGCCTGGCTTGCCCTTGG + Intergenic
1111091672 13:83453959-83453981 CTCCACTCCTCGTTTACTCTTGG + Intergenic
1111192896 13:84832505-84832527 CTCCATGCCTGGCTCACCCTAGG + Intergenic
1111243860 13:85509115-85509137 CTGTAGGCCTGGCTTGCCCTTGG + Intergenic
1111474457 13:88726328-88726350 CTCCACATCTGGCTTGCCCTTGG + Intergenic
1113229470 13:108196024-108196046 CTCAACACCTGGCTTGCCCTTGG + Intergenic
1113916990 13:113880170-113880192 ATCCAAGCCTGGGTTGCCATTGG - Intergenic
1114344658 14:21781868-21781890 CTCCGTGCCTGGCTTACCCTTGG + Intergenic
1114349449 14:21834792-21834814 CTCCATGCCTGACTCGCCCTTGG - Intergenic
1114613062 14:24054613-24054635 CCCCACTCCTGGTTTTTCCTGGG + Intronic
1114651450 14:24287249-24287271 CTCCTGGACTGCTTTGCCCTGGG + Intergenic
1114715749 14:24822164-24822186 CTCCACACCTGTTTTTCCTTTGG + Intronic
1115027509 14:28761591-28761613 TTCCACGCCTGGCTCTCCCTTGG + Intergenic
1115961485 14:38838665-38838687 TTCCACGCCTGTCTCGCCCTGGG + Intergenic
1116151146 14:41144553-41144575 CTCCACACCTGGCTCACCCTTGG - Intergenic
1116313632 14:43359455-43359477 CTCCACAGCTGGCTCGCCCTTGG - Intergenic
1119257032 14:73207786-73207808 CTCCATGCCTGGCTTGCCTTTGG - Intronic
1121368784 14:93338046-93338068 CTCTGCGCCTGGCTCGCCCTTGG + Intronic
1121645258 14:95514148-95514170 CTCCAACCCTGGGCTGCCCTGGG - Intergenic
1122385965 14:101348473-101348495 CTCCACACCTGGCTACCCCTTGG - Intergenic
1202941468 14_KI270725v1_random:151831-151853 CTCAACTCCTGGCTTCCCCTTGG - Intergenic
1124436430 15:29652814-29652836 CTCCACGCCTGGCTCAACCTTGG + Intergenic
1125862204 15:43009437-43009459 CTCCACACCTGGCTTGCCCTTGG + Intronic
1126215339 15:46147186-46147208 CTCCATGCCTGGCTTGCCCTTGG + Intergenic
1127019237 15:54727413-54727435 CTCCACACCTGGCTCACCCTTGG + Intergenic
1127269020 15:57384153-57384175 CTCCAGGCCTGGCTTGCTCATGG + Intronic
1130103128 15:80909085-80909107 CTCCTCTCCTAGTTTGCTCTGGG + Exonic
1130381970 15:83379198-83379220 CTCCACGCTTGGCTTGGCCTGGG - Intergenic
1130807322 15:87338601-87338623 CTCTATTCCTGGTTTGCCCATGG - Intergenic
1131559922 15:93430700-93430722 CTAAACCCCTGGATTGCCCTGGG - Intergenic
1131568194 15:93505669-93505691 CTCCGCACCTGGCTCGCCCTTGG - Intergenic
1132225869 15:100140974-100140996 CCCCACCCCTGATTTGGCCTGGG - Intronic
1132590990 16:726407-726429 CTCCACGCCCGGCTTCCCCATGG + Exonic
1132593223 16:735581-735603 CCCCAGGCCAGGTTTTCCCTGGG + Intronic
1132873948 16:2127761-2127783 CTCCACCTCTGGTGTGACCTTGG - Intronic
1133090648 16:3401337-3401359 CTCCACGCCCGGTGTGAGCTCGG - Intronic
1134553034 16:15146935-15146957 CTCCACTTCTGGTGTGACCTTGG - Intergenic
1135986925 16:27190620-27190642 CTCCATGCCTGGCTCACCCTTGG + Intergenic
1138878417 16:60980177-60980199 CTCCACGCCTGGCTCACCCTTGG + Intergenic
1139015591 16:62685031-62685053 CTCCACCCTTGGCTTGCCCTTGG + Intergenic
1139395481 16:66635433-66635455 CTGCTCTCCTGGTGTGCCCTGGG - Intronic
1139463505 16:67141556-67141578 CTCCATGCCTGGCTTGCCCTTGG - Intronic
1142331714 16:89458715-89458737 ATCCAAGCCTGCTTTGCCTTTGG + Intronic
1142850820 17:2703964-2703986 CTCCACGCTGGCTCTGCCCTTGG + Intronic
1142905018 17:3035579-3035601 CTCCATGCCCGGTTTGCTGTTGG + Exonic
1144390100 17:14785138-14785160 CTCTCTGCCTGGCTTGCCCTTGG + Intergenic
1144793263 17:17873742-17873764 CTCCAGGCCTGCTTCTCCCTGGG + Intronic
1144851599 17:18246747-18246769 TTCCTCGCCTTCTTTGCCCTCGG + Exonic
1146087061 17:29839258-29839280 CCCCATGCCTGGCTCGCCCTTGG + Intronic
1147772336 17:42876690-42876712 CACCATGCCTGGACTGCCCTGGG + Intergenic
1149256743 17:54836172-54836194 CTCCACACCTGGCTTGCCCTTGG - Intergenic
1149668143 17:58380884-58380906 TTCCACAACTGGCTTGCCCTGGG + Intronic
1151884170 17:76913690-76913712 CTCCACATCTGGCTTGCTCTTGG - Intronic
1152530599 17:80916482-80916504 CTCTGCGCCTGGCTTGCCTTTGG + Intronic
1153608307 18:6855956-6855978 CTCCGCACCTAGCTTGCCCTTGG + Intronic
1155830749 18:30512979-30513001 CTGCACACCTGGCTTGCCCTTGG - Intergenic
1156244311 18:35283512-35283534 CTTCACGCCTGGCTCACCCTTGG - Intronic
1158888983 18:61855706-61855728 CTCCACGTCTGGCTCGCCCTTGG + Intronic
1159398320 18:67894102-67894124 CTTCACACATGGTTTGCTCTGGG - Intergenic
1159518966 18:69494968-69494990 CTCCACACCTGGCTCGCACTTGG - Intronic
1159930830 18:74311656-74311678 CTCCACACCTGGCTCACCCTTGG - Intergenic
1160083450 18:75753022-75753044 CTCCACACCTGGCTCACCCTTGG - Intergenic
1160116501 18:76084222-76084244 CTCTGGGCCTGGCTTGCCCTTGG - Intergenic
1161146783 19:2683693-2683715 CTCCTCACCTGGAATGCCCTCGG - Intronic
1161780347 19:6287512-6287534 CTCCATGCCTGGCTTGCCCTTGG + Intergenic
1164897786 19:31892171-31892193 GTCCACGGCTGTTTTGCTCTGGG - Intergenic
1164984557 19:32638849-32638871 CTCCACACCTGGCTCGCCCTTGG + Intronic
1165724692 19:38104516-38104538 CTCCACGCCAGGTGAGCCCAGGG - Intronic
1165902261 19:39174365-39174387 CTCCACTCCTGGGTGTCCCTCGG + Intronic
1166921260 19:46230559-46230581 CTGCATGCCTGTTCTGCCCTGGG + Intronic
1168630033 19:57949422-57949444 CTCCGCGCCTGGCTCGCCCTTGG - Intergenic
926006694 2:9378400-9378422 CTCCTCGGCCTGTTTGCCCTGGG - Intronic
926070382 2:9884032-9884054 TTCCATGCCTGACTTGCCCTTGG - Intronic
926675680 2:15618469-15618491 CTCCGCGCCTGGCTCACCCTTGG - Intronic
927533720 2:23836125-23836147 CCCCATGCCTGGCTTGCCCCTGG - Intronic
928638010 2:33267248-33267270 CTCCACACCTGGCTTGCCCTTGG + Intronic
930729138 2:54710427-54710449 CTCCACGCCTGACTTGCCCTTGG + Intergenic
931300647 2:60974827-60974849 CTCCACGCCTGGCTTGCCCTTGG + Intronic
931500206 2:62856529-62856551 CTCCATGCCTGACTCGCCCTTGG + Intronic
932054587 2:68431801-68431823 CTCCACGCCTGGCTTGCCCTTGG - Intergenic
932567248 2:72917777-72917799 CTCCGCGCCTGGCTCGCCCGCGG + Exonic
933609176 2:84416090-84416112 CTCCATGTCTGGTTTGGCTTGGG + Intergenic
933801018 2:85960590-85960612 CTCCATGCCTGACTTGCCCTTGG - Intergenic
934696392 2:96403702-96403724 GTCCATGTCTGGCTTGCCCTTGG - Intergenic
934700032 2:96431527-96431549 TTCCATGCCTGACTTGCCCTTGG + Intergenic
934853727 2:97716642-97716664 CACCATGCCTGGTTTGTCCGAGG + Intronic
935518644 2:104077614-104077636 CTCCACCCCTGACTAGCCCTTGG - Intergenic
937167953 2:119837964-119837986 CTCCGCGCCTGACTCGCCCTTGG + Intronic
937304264 2:120861561-120861583 CTCCAAGCCTGGGCTGCTCTTGG + Intronic
938096314 2:128466504-128466526 CTCCATGCCTGGCTTGCCCTTGG - Intergenic
938721975 2:134075445-134075467 CTCCATGCCTGGCTTGCCCTTGG - Intergenic
938765618 2:134459159-134459181 CGCCAGGCCTGGCTTCCCCTGGG + Intronic
939802027 2:146721686-146721708 CTCCGCACCTGGCTTGCCCTTGG + Intergenic
940422656 2:153498418-153498440 CTCTGCGCCTGGCTCGCCCTTGG - Intergenic
940582450 2:155599967-155599989 CTCAACACCTGGCTTGCCCTTGG - Intergenic
941043750 2:160649901-160649923 CTCCACACCTGGCTCGCCCTTGG + Intergenic
941131194 2:161651807-161651829 CTCTGCGCCTAGCTTGCCCTTGG + Intronic
941999004 2:171627641-171627663 CTCCCTGCCTGGCTTGCCTTTGG + Intergenic
942315508 2:174693329-174693351 CTCCGCACCTGGCTTGCCCCTGG + Intergenic
943023364 2:182601162-182601184 CTCCATGCCTGGCTCACCCTTGG - Intergenic
943179302 2:184523814-184523836 CTCCGCGCCTGACGTGCCCTTGG - Intergenic
943441816 2:187934923-187934945 CTCCATGCCTGGCTTGCGCTCGG - Intergenic
943965695 2:194328751-194328773 CTCCACACCTGGCTCACCCTTGG + Intergenic
944620009 2:201504770-201504792 TTCCATGCCAGGTTTTCCCTGGG + Intronic
945844458 2:214927652-214927674 CACCACGCCCGGCTTGCCCAAGG - Intergenic
946495761 2:220193530-220193552 CTCTACACCTGGCTTGCCCATGG + Intergenic
948007365 2:234621386-234621408 ATGCAAGCCTGGTGTGCCCTGGG + Intergenic
948334802 2:237199712-237199734 CTCTGTGCCTGGCTTGCCCTAGG - Intergenic
948713308 2:239839467-239839489 CTCCATGCCTGGCTCGCCCTTGG + Intergenic
1168983292 20:2026141-2026163 CTCCATGGCTGGCTTACCCTTGG - Intergenic
1169498253 20:6134869-6134891 CTCCAGGCCAGGTTTTGCCTGGG - Intergenic
1169880631 20:10342405-10342427 GTCCATGCCTGGCTTGCCCTTGG + Intergenic
1170221684 20:13947947-13947969 CTCCATGCTTGGCTCGCCCTTGG + Intronic
1170458506 20:16554971-16554993 CTCCATGCCTGGCTTGCCCTTGG + Intronic
1170769082 20:19316649-19316671 GTCCAGGCCAGGTTGGCCCTAGG + Intronic
1171537352 20:25906983-25907005 CTCAACTCCTGGCTTCCCCTTGG - Intergenic
1171803759 20:29654303-29654325 CTCAACTCCTGGCTTCCCCTTGG + Intergenic
1171840305 20:30202322-30202344 CTCAACTCCTGGCTTCCCCTTGG - Intergenic
1172347153 20:34210535-34210557 CTCCATGCCTGGCTTGCCTTTGG + Intronic
1172616071 20:36285704-36285726 CTCCACCACTGGCTTGCTCTTGG + Intergenic
1173468030 20:43299854-43299876 CTCCACTCCTTGTTAGCCATGGG - Intergenic
1173482784 20:43416427-43416449 CTCAAGGGCAGGTTTGCCCTGGG - Intergenic
1173740276 20:45395285-45395307 CTCCATGCCTGGCTTACCCTTGG + Intronic
1173884423 20:46445142-46445164 CTCCATGCCTGACTTGCCTTTGG - Intergenic
1173893310 20:46530229-46530251 CTCCACACCTGACTTGTCCTAGG - Intergenic
1175975227 20:62707623-62707645 CTCCATGTCTGGGTTGCCCAGGG - Intergenic
1176088112 20:63307186-63307208 CTCCTTGCCTGGTTTGCACCTGG + Intronic
1176104731 20:63380659-63380681 CTCTGCGCCTGGCTAGCCCTCGG + Intergenic
1176408547 21:6435141-6435163 TTCCACGCCTGACTCGCCCTTGG + Intergenic
1176581694 21:8535103-8535125 CTCAACTCCTGGCTTCCCCTTGG + Intergenic
1177344531 21:19853221-19853243 CTCCACGCCTGGCTTGCCCTTGG - Intergenic
1177459865 21:21396565-21396587 CTCCCCACCTGGTTCACCCTTGG - Intronic
1178664376 21:34533869-34533891 CTCCACACCTGCTGTTCCCTGGG - Intronic
1179684039 21:43043463-43043485 TTCCACGCCTGACTCGCCCTTGG + Intergenic
1180025989 21:45162404-45162426 CTCCACACCTGGCTCCCCCTTGG + Intronic
1180264529 22:10512175-10512197 CTCAACTCCTGGCTTCCCCTTGG + Intergenic
1183522220 22:38302206-38302228 CACCACGTCTGGCCTGCCCTGGG - Intronic
949226491 3:1700873-1700895 CTCCATGCCTGGCTCACCCTTGG + Intergenic
949547036 3:5081315-5081337 CTCCCTGCCTGGCTTGCTCTCGG + Intergenic
951136101 3:19106350-19106372 CTCCATGCCTGACTTGCCCTTGG - Intergenic
951566680 3:24018907-24018929 CTCCACGCCTGGCTCACCCTTGG - Intergenic
951718332 3:25673032-25673054 CTCCATGCCTGGCTCACCCTTGG - Intergenic
952793473 3:37218427-37218449 CTCCATGCCTGGCTTGCCATTGG + Intergenic
953748049 3:45590324-45590346 CTCCATGGCTGGCTTGCCCTTGG - Intronic
953984470 3:47430821-47430843 CTCCACGCCTGGGCTGCAGTCGG + Intronic
954498154 3:50984096-50984118 CTCCATGCCTTACTTGCCCTTGG + Intronic
954552113 3:51490634-51490656 CACCATGCCTGGTTTGTCATTGG - Intronic
955111759 3:55957635-55957657 CTCCATGCCTGGCTTGCCCTTGG - Intronic
955303924 3:57810293-57810315 CTCCATGCCTGGCTTGCCGTTGG + Intronic
956989858 3:74751071-74751093 CTCCACACCTGGCTCGCCCTCGG - Intergenic
957019748 3:75112224-75112246 CTCCACTCCTGGTATACCCCCGG - Intergenic
957307892 3:78481271-78481293 TTCCATGCCTGGCTTGCCCTTGG + Intergenic
957418026 3:79930381-79930403 CTCCACGCCTGGCTCGCCCTTGG + Intergenic
958141645 3:89570561-89570583 TTCCATTCCTGGTTTGCCCTTGG - Intergenic
958677961 3:97291965-97291987 CTCCGTGCCTGGCTTGCCCTTGG - Intronic
958977543 3:100683603-100683625 CTCCACACCTGGCTCGTCCTTGG + Intronic
959016037 3:101135046-101135068 CTTCACGTCTGTTATGCCCTTGG + Intergenic
959863547 3:111242085-111242107 CTCCATGCCTGACTTGCCCTTGG - Intronic
961311524 3:126004889-126004911 CTCCATGCCTGGCTCACCCTTGG + Intergenic
961942850 3:130655892-130655914 CTCCATGCCTGGCTTGCCCTTGG - Intronic
962211880 3:133486406-133486428 CTCCATGCCTGGCTCACCCTTGG - Intergenic
963780515 3:149481652-149481674 CTCCACACATGGTGTGTCCTGGG - Intronic
964996909 3:162892597-162892619 CTCTACGCCTGGTATGCCCTTGG + Intergenic
965118484 3:164521297-164521319 CTCCTCACCTGGGTAGCCCTTGG - Intergenic
965367888 3:167821572-167821594 CTCCACACCTGGCTCGCCCTTGG + Intronic
966254337 3:177899946-177899968 CTCCATGCCTGGCTTGCCCTTGG + Intergenic
966840279 3:184082303-184082325 CTCCACACCTGGCTTGCCCTTGG + Intergenic
967649765 3:191972738-191972760 CTCCACGCCTGGCTCATCCTTGG - Intergenic
968142823 3:196272982-196273004 CTCCGTGCCTGGCTTGTCCTTGG - Intronic
968164426 3:196452933-196452955 CTCCACACCTGCCTCGCCCTTGG - Intergenic
968838203 4:2980900-2980922 CTCTGCACCTGGCTTGCCCTTGG - Intronic
969179366 4:5425131-5425153 CTCTGTGCCTGGCTTGCCCTTGG + Intronic
969533515 4:7741998-7742020 CTCCACGCCTGTGTGGCCCAGGG - Exonic
969537676 4:7766739-7766761 TTCCATGCCTGGATGGCCCTTGG + Intronic
969632173 4:8345194-8345216 CTCCACGGCCGGGCTGCCCTGGG - Intergenic
970186107 4:13455327-13455349 CTCAAGGGCAGGTTTGCCCTGGG + Intronic
971092540 4:23361663-23361685 CTCCATGCCTGGCTTGCCCTTGG + Intergenic
972158698 4:36197642-36197664 CTCCACACCTGGCTTGCCGTTGG - Intronic
972473874 4:39432650-39432672 TTCCATGCCTGGCTTGCCCTGGG - Intronic
974260155 4:59517146-59517168 CTCCATGCCTGACTTGCCCTTGG - Intergenic
974515174 4:62898371-62898393 CTCCACACCTGGCTCACCCTTGG + Intergenic
974521488 4:62986906-62986928 CTCTGTGCCTGGTTTGCCCTTGG - Intergenic
974629017 4:64458653-64458675 CCCCACACCTAGCTTGCCCTTGG + Intergenic
974683372 4:65194131-65194153 CTCCTTGCCTGGCTTGCCCTTGG - Intergenic
974761693 4:66285082-66285104 CTCTGCACCTGGCTTGCCCTAGG - Intergenic
974894990 4:67927533-67927555 CTCCATGCCTGGGTTGGCCTTGG + Intronic
975008585 4:69321466-69321488 TTCTACACCTGGCTTGCCCTTGG + Intronic
975671688 4:76786990-76787012 CTCCACCTCTGCTTGGCCCTGGG - Intergenic
976729281 4:88245509-88245531 CTTCATGCCTGGCTTGCTCTTGG + Intergenic
978107864 4:104926402-104926424 CATCACACCTGGTTTGCTCTAGG - Intergenic
978149233 4:105414452-105414474 CTCCATACCTGGCTTGCCCTTGG - Intronic
979090447 4:116477179-116477201 CTCCACGCCTGGCTTGCCCTTGG - Intergenic
979648836 4:123106852-123106874 CTCCACGCCTCGCTCGCCCTTGG - Intronic
980007724 4:127560214-127560236 CTCCACGCCTGACTCGCCCTTGG + Intergenic
980322590 4:131298084-131298106 CTACACCACTGGTTTGCCCGGGG + Intergenic
980703250 4:136458554-136458576 CTCTATGCCTGGCTTGCCCTTGG + Intergenic
981727213 4:147861123-147861145 CTCCGTGCCTGGCTCGCCCTTGG - Intronic
981889080 4:149715238-149715260 CTCCATGCCTGGCTCACCCTTGG - Intergenic
982157914 4:152539697-152539719 CTCCACGCCGTACTTGCCCTTGG - Intergenic
982957837 4:161793238-161793260 CTCCATGCCTGGCTCACCCTTGG + Intronic
983379983 4:166980565-166980587 CTCTGCTCCTGGCTTGCCCTTGG - Intronic
984296798 4:177862908-177862930 CTCTGCACCTGGCTTGCCCTTGG + Intronic
985916375 5:2921858-2921880 CTCCATGCCTGGCTCACCCTTGG + Intergenic
986155232 5:5167747-5167769 CTCCACAAGTGCTTTGCCCTGGG + Intronic
987537817 5:19209795-19209817 CTCCATACCTGCCTTGCCCTTGG + Intergenic
987815868 5:22900948-22900970 CTCCACTCCTGGCTTACCCTCGG - Intergenic
987999709 5:25331906-25331928 CTCCATGCCTGGCTTGCCCTTGG + Intergenic
988081040 5:26416059-26416081 CTCCACACCTGGCTTGCCCTTGG - Intergenic
988093105 5:26568435-26568457 CTCCATGCCTGACTTGCCCTTGG - Intergenic
988940516 5:36140320-36140342 CTCCATGCCTGGCTCGCCCTTGG + Intronic
989520798 5:42397430-42397452 CTCTGTGCCTGGCTTGCCCTTGG + Intergenic
989537727 5:42582955-42582977 CTCCACGCCTGGCTTGCCCTTGG + Intronic
989732603 5:44665503-44665525 CTCTGGGCCTGGCTTGCCCTTGG + Intergenic
990923350 5:60993053-60993075 CTCCATGTCTGGTTCACCCTTGG - Intronic
992838788 5:80667551-80667573 CTCCACTCCTGGCTCACCCTTGG - Intronic
994115230 5:96054405-96054427 CACCATGCCTGGCTTGTCCTGGG + Intergenic
994449818 5:99928587-99928609 TTCCAAGCCTGACTTGCCCTTGG - Intergenic
994451973 5:99955151-99955173 CTCTGTGCCTGGCTTGCCCTTGG - Intergenic
994692237 5:103033801-103033823 CTCTGTGCCTGGCTTGCCCTTGG - Intergenic
994753099 5:103763515-103763537 CTCCACACCTGACTCGCCCTTGG - Intergenic
994948238 5:106423743-106423765 CTGTGCGCCTGGCTTGCCCTTGG + Intergenic
995146139 5:108788347-108788369 CTCCACTCCTGGCTCACCCTTGG + Intronic
995742548 5:115369645-115369667 CTCTGTGCCTGGTTTGCCCTTGG + Intergenic
995863100 5:116661960-116661982 CTCTATGCCTGGCTTGCCTTTGG + Intergenic
996176906 5:120369551-120369573 CTCCACACCTGGCTCACCCTTGG + Intergenic
997473249 5:134128419-134128441 TTCCACGCCTTGTTTCCCTTTGG + Intronic
997711521 5:136008722-136008744 CTCCATGCCAGTTGTGCCCTGGG - Intergenic
1001104290 5:168839923-168839945 CACCTCGCCTGGTTCACCCTAGG - Intronic
1002072290 5:176687432-176687454 CTCCACGCCTGACTCGTCCTTGG - Intergenic
1002450667 5:179316615-179316637 CTCCGTGCCTGCTCTGCCCTGGG - Intronic
1002696768 5:181097610-181097632 CTCGACGCCTTGTTGGCCCGGGG - Intergenic
1002697854 5:181101763-181101785 CTCGACGCCTTGTTGGCCCGGGG + Intergenic
1003379538 6:5610859-5610881 CTCCATCCCTGGATTGTCCTAGG - Intronic
1005667989 6:28077432-28077454 CTCCAGCCCTGGCTTCCCCTGGG + Intergenic
1007214916 6:40229298-40229320 CTCCATGCCTGGCTCACCCTTGG + Intergenic
1007240647 6:40422558-40422580 CCCCACTCCTGGTCTGACCTGGG + Intronic
1007396698 6:41582066-41582088 CTCCTCCCCTGGTGTGCCTTAGG - Intronic
1007833477 6:44656226-44656248 CTCCACTCTTGGTTTCCACTTGG + Intergenic
1008330534 6:50239987-50240009 CTCCACGCCTCGCTCGCCCTTGG - Intergenic
1009243244 6:61204212-61204234 CTCTGCACCTGGCTTGCCCTTGG - Intergenic
1009588758 6:65638747-65638769 CTCCATGCCTGGCTTACCCTTGG + Intronic
1009870736 6:69450030-69450052 CTCCATGCCTGGCTTGCCCTTGG - Intergenic
1010519829 6:76818722-76818744 CTCCGCACCTGGCTTGCCCTTGG + Intergenic
1011795674 6:90948730-90948752 CTCCACGCCTGGCTCACCCTTGG + Intergenic
1011930031 6:92700582-92700604 TTCCACGCCTGGCTTGCCCTTGG - Intergenic
1012749409 6:103139526-103139548 TTCCATTCCTGGCTTGCCCTTGG - Intergenic
1012990701 6:105922850-105922872 CTCCAGTCCTGGTTTGGTCTGGG - Intergenic
1014384847 6:120786975-120786997 CTCCGCACCTGGCTTTCCCTTGG + Intergenic
1014392062 6:120874671-120874693 CTCCATGCCTGGTTCGCCCTTGG + Intergenic
1014505170 6:122246996-122247018 CTCCACACCTGGCTCACCCTTGG - Intergenic
1015143452 6:129959714-129959736 CTCAGTGCCTGGCTTGCCCTTGG + Intergenic
1016076640 6:139804319-139804341 CTCCATGTCTGGCTTGCCCTTGG - Intergenic
1016986587 6:149900133-149900155 CTCCATGGCTGGTTTTCCCAGGG + Intergenic
1017588052 6:155948102-155948124 CTCCATGCCTGGCTTGCCCTTGG + Intergenic
1018659849 6:166076113-166076135 CTCCATGCCTGGCTTGCCCTTGG - Intergenic
1019816627 7:3205801-3205823 CACCACGCCTGGCCTGGCCTGGG - Intergenic
1020761370 7:12270790-12270812 CTCTGTGCCTGGCTTGCCCTTGG + Intergenic
1020832432 7:13109365-13109387 CTCCACACCTGGCTTGCCCTTGG - Intergenic
1021342995 7:19488203-19488225 CTCTGCACCTGGCTTGCCCTTGG - Intergenic
1022157856 7:27678367-27678389 CTCCTTACCAGGTTTGCCCTTGG - Intergenic
1024856920 7:53793712-53793734 CTCTACACCTCGCTTGCCCTTGG - Intergenic
1025288828 7:57693817-57693839 CTCAACTCCTGGCTTCCCCTTGG - Intergenic
1026391801 7:69910374-69910396 CTCTACGCCTGGCTCGCCCTTGG - Intronic
1027734784 7:81919671-81919693 CTCCACACCTGGCTTGTCCTTGG - Intergenic
1027911938 7:84261719-84261741 CTCTCCGCCTGGCTCGCCCTTGG + Intronic
1028816749 7:95156097-95156119 CTCCATGCCTGACTTACCCTTGG - Intronic
1030484364 7:110148186-110148208 CTCTGCTCCTGGCTTGCCCTTGG - Intergenic
1030722070 7:112882212-112882234 CTCTGCACCTGGCTTGCCCTTGG + Intronic
1031836908 7:126690267-126690289 CTCCGTGCCTGCCTTGCCCTTGG - Intronic
1034101675 7:148456492-148456514 CTCTGTGCCTGGCTTGCCCTTGG - Intergenic
1035252259 7:157605143-157605165 CTCCATGCCTGACTCGCCCTTGG - Intronic
1036907764 8:12721258-12721280 CTCCGTGCCTGGTTCGCTCTTGG + Intergenic
1036915330 8:12799049-12799071 CTCCACACCTGGCTCACCCTTGG - Intergenic
1037777737 8:21846892-21846914 CTCCACGACTGGGTTGTTCTTGG - Intergenic
1041205372 8:55494080-55494102 CTCTGTGCCTGGCTTGCCCTTGG - Intronic
1041956070 8:63559083-63559105 CTCCATGCCTGGCTTGCCCTTGG - Intergenic
1041965365 8:63669482-63669504 CTCCACACCTGGCTTGCACTTGG - Intergenic
1042439554 8:68810186-68810208 CTCTGTGCCTGGCTTGCCCTTGG - Intronic
1042642975 8:70955738-70955760 CTGCACACCTGGCCTGCCCTTGG - Intergenic
1043180454 8:77082096-77082118 CTCTGTGCCTGGCTTGCCCTTGG - Intergenic
1043695377 8:83209690-83209712 CTCTGCACCTGGCTTGCCCTTGG + Intergenic
1043707934 8:83377403-83377425 CTCCACACCTGGCTTGCGCTTGG - Intergenic
1044585313 8:93864171-93864193 CACCATGCCTGGATTCCCCTTGG + Intronic
1045222670 8:100213642-100213664 GTCCCCGCCGGGTTTTCCCTTGG + Intronic
1046140513 8:110084112-110084134 CTCCACACCTGGCTTGCCCTTGG + Intergenic
1046249506 8:111611760-111611782 CTCCCCGCCTGGCTTGCCCTCGG - Intergenic
1046503625 8:115110736-115110758 CTCTGCGCCTGGCTCGCCCTTGG - Intergenic
1046775507 8:118159420-118159442 CTCTTTGTCTGGTTTGCCCTTGG + Intergenic
1047104559 8:121719203-121719225 CTTCACACCTGGCTCGCCCTTGG - Intergenic
1048001186 8:130380654-130380676 CTCCATGCATGGGTTGCACTGGG - Intronic
1049140605 8:140950533-140950555 CTCTGCGCCTGGCTCGCCCTTGG + Intronic
1049201459 8:141342604-141342626 CTCCAGGCCTGTCTTCCCCTTGG + Intergenic
1049394257 8:142391805-142391827 CTCCATGCCTGGCTCACCCTTGG + Intronic
1049668071 8:143857038-143857060 CTCCACACATGGGTTGCCTTTGG - Intergenic
1049791907 8:144476029-144476051 CTCCACCCCTGAGTTGCCTTTGG + Exonic
1050182460 9:2935179-2935201 CTCCGCACCTGGCTTGCCCTTGG + Intergenic
1050589527 9:7147983-7148005 CTCCAAGCCTGGCTTGCCCTTGG - Intergenic
1050809047 9:9719993-9720015 CTCCACACCTGGCTCACCCTTGG + Intronic
1050888258 9:10791527-10791549 CTCCACACCTGGCTCACCCTTGG + Intergenic
1053619047 9:39797908-39797930 CTCCGTGCCTGGCTTACCCTTGG - Intergenic
1054265109 9:62909521-62909543 CTCCGTGCCTGGCTTACCCTTGG + Intergenic
1055816657 9:80213856-80213878 CTCCACACCTGGCTTGCCCTTGG + Intergenic
1056517650 9:87370712-87370734 CTCTGCGCCTGGCTTGCCCATGG - Intergenic
1056994316 9:91442526-91442548 CTCTGCGCCTGGCTCGCCCTTGG - Intergenic
1058487553 9:105457735-105457757 CTCCATGCCTGGCTCGCCCTCGG - Intronic
1059104946 9:111502679-111502701 CTCCAAGCGTGGCTTGCCCTTGG + Intergenic
1059516786 9:114903286-114903308 GTCCCAGCCTGGTTTTCCCTGGG + Exonic
1059681652 9:116591417-116591439 CTCCATGGCTGGCTTGCCCTTGG + Intronic
1060630277 9:125151629-125151651 CCCCACCCCTTGTTTTCCCTTGG + Intronic
1061267469 9:129515142-129515164 CTCCACACCTGGCTCGCCCTTGG + Intergenic
1061743092 9:132721768-132721790 CTCTGCACCTGGCTTGCCCTTGG - Intergenic
1061825055 9:133252678-133252700 CTCCAGGCCCGGTTTGTCCTGGG + Intronic
1062674363 9:137731757-137731779 CTCCACTCCTGGCTTGCCCTCGG - Intronic
1185758367 X:2670304-2670326 CCACACTCCTGGTGTGCCCTTGG + Intergenic
1186193395 X:7087792-7087814 CTCATCGCCTGTATTGCCCTGGG - Intronic
1186506558 X:10097974-10097996 CACCGCGCCTGGCTTGCCCTTGG + Intronic
1188647997 X:32593035-32593057 CTCTGTGCCTGGCTTGCCCTTGG + Intronic
1189024010 X:37371820-37371842 CTCTATGCCTGGCTTGCCCTTGG + Intronic
1190360444 X:49644191-49644213 TTCCATGCCTGGCTTGCCCTTGG - Intergenic
1190621313 X:52289137-52289159 CTCTATGCCTGTCTTGCCCTTGG + Intergenic
1192267331 X:69547735-69547757 CTCCACACCTGGCTCACCCTTGG + Intergenic
1194212328 X:91083421-91083443 CTCCACACCTGCCTTGCCCTTGG + Intergenic
1194891369 X:99383956-99383978 CTCTGTGCCTGGCTTGCCCTTGG - Intergenic
1195320029 X:103714285-103714307 CTCCACCCCTGTTCTTCCCTTGG + Intronic
1195942681 X:110178719-110178741 CTCCATGCCTGGTGTGCAGTTGG - Intronic
1197501138 X:127243814-127243836 CTCCATGCCTCAGTTGCCCTTGG - Intergenic
1197527354 X:127578624-127578646 CTCTGTGCCTGGCTTGCCCTTGG + Intergenic
1198189598 X:134288836-134288858 CTCCATGCCTGGCTCACCCTTGG + Intergenic
1199359892 X:146906295-146906317 CTCCAGGCCTGACTTGCCCTTGG - Intergenic
1199614918 X:149648632-149648654 TTCCACGCCTGACTCGCCCTTGG + Intergenic
1200392292 X:155956311-155956333 CTCCACGCCTGACTCGCCCTTGG - Intergenic
1200411647 Y:2867663-2867685 CTCCACGCCTGGTTTGCCCTTGG - Intronic
1200424757 Y:3008740-3008762 CTGCACATCTGGCTTGCCCTTGG - Intergenic
1201270504 Y:12249341-12249363 GTCCAGGCTTGGTTTGGCCTAGG - Intergenic
1201368355 Y:13234144-13234166 CTCCACATCTGGCTGGCCCTTGG - Intergenic