ID: 1200412025

View in Genome Browser
Species Human (GRCh38)
Location Y:2870330-2870352
Sequence AAAAATCCAAAAATGGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64920
Summary {0: 1, 1: 2, 2: 66, 3: 2276, 4: 62575}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200412022_1200412025 13 Left 1200412022 Y:2870294-2870316 CCAGTCTGGTCAACATGGTGAAA 0: 215
1: 9502
2: 117201
3: 177012
4: 191219
Right 1200412025 Y:2870330-2870352 AAAAATCCAAAAATGGAGCCAGG 0: 1
1: 2
2: 66
3: 2276
4: 62575
1200412019_1200412025 27 Left 1200412019 Y:2870280-2870302 CCAGGAGTTCAAGACCAGTCTGG 0: 1092
1: 20497
2: 41144
3: 59987
4: 51716
Right 1200412025 Y:2870330-2870352 AAAAATCCAAAAATGGAGCCAGG 0: 1
1: 2
2: 66
3: 2276
4: 62575

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200412025 Original CRISPR AAAAATCCAAAAATGGAGCC AGG Intronic
Too many off-targets to display for this crispr