ID: 1200412323

View in Genome Browser
Species Human (GRCh38)
Location Y:2872994-2873016
Sequence CAGTCTTACTAGAAAGAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 132}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200412320_1200412323 19 Left 1200412320 Y:2872952-2872974 CCTGTTTTATCCTGATCATGATA 0: 1
1: 0
2: 0
3: 11
4: 132
Right 1200412323 Y:2872994-2873016 CAGTCTTACTAGAAAGAGGTTGG 0: 1
1: 0
2: 0
3: 10
4: 132
1200412321_1200412323 9 Left 1200412321 Y:2872962-2872984 CCTGATCATGATATTTATTTCTT 0: 1
1: 0
2: 1
3: 44
4: 598
Right 1200412323 Y:2872994-2873016 CAGTCTTACTAGAAAGAGGTTGG 0: 1
1: 0
2: 0
3: 10
4: 132
1200412319_1200412323 20 Left 1200412319 Y:2872951-2872973 CCCTGTTTTATCCTGATCATGAT 0: 1
1: 0
2: 0
3: 14
4: 211
Right 1200412323 Y:2872994-2873016 CAGTCTTACTAGAAAGAGGTTGG 0: 1
1: 0
2: 0
3: 10
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200412323 Original CRISPR CAGTCTTACTAGAAAGAGGT TGG Intronic
905348396 1:37327535-37327557 GAGTCTTACTAGAAAGAACTGGG - Intergenic
905540960 1:38760125-38760147 CAGCCTTAGCAGAAAGAGGCTGG - Intergenic
909847314 1:80411435-80411457 CAGTTTTAATATAAAGTGGTAGG - Intergenic
912367727 1:109148875-109148897 CTTTCCTACTAGAAAGAGATTGG + Intronic
914999998 1:152580230-152580252 CAGCCTGAGTAGAAAGAGGATGG + Intronic
916576226 1:166069537-166069559 CAATCTTTTTGGAAAGAGGTGGG + Intronic
916786106 1:168088231-168088253 AAGTCCTACTAGAGATAGGTGGG + Intronic
917427131 1:174926090-174926112 CAGTATTATTACAAATAGGTGGG - Intronic
920361739 1:205422683-205422705 CAGTCTTTCTTGAAAGATGCAGG - Intronic
1065707765 10:28486889-28486911 TAGTCTGACTAGAATGAAGTAGG - Intergenic
1068204823 10:53836353-53836375 CACTCTTATAAGGAAGAGGTGGG - Intronic
1070523337 10:77274159-77274181 TAGTCATACTTGAAAGAGTTAGG - Intronic
1071675437 10:87651399-87651421 CAGTTTTCCTGGAAAGGGGTGGG - Intergenic
1071997969 10:91164697-91164719 CAGTCTTACTAATGTGAGGTGGG - Intronic
1072440740 10:95452665-95452687 CAGACTACCTAGAAATAGGTTGG + Intronic
1074559041 10:114518886-114518908 CAATCTTCCTAGAAGCAGGTGGG + Intronic
1075892689 10:125967336-125967358 CAGTCTTACAGGTAAAAGGTAGG + Intronic
1076276943 10:129208135-129208157 CATCCTTACTAAAAAGAGCTAGG + Intergenic
1078858042 11:15222301-15222323 CACTTTTAAAAGAAAGAGGTGGG - Intronic
1083251899 11:61473847-61473869 CAGTCTGAGTAGTTAGAGGTGGG - Intronic
1083448278 11:62725686-62725708 AAGTCTTACTATAAAGTGGGTGG - Intronic
1084284011 11:68120290-68120312 CTGTGTTACTAGACAAAGGTGGG - Intronic
1085077137 11:73601222-73601244 GAGTCTAACTAGAGTGAGGTGGG - Intergenic
1087013154 11:93532174-93532196 CAGTCATACTAGAATAGGGTGGG + Intronic
1087026502 11:93654925-93654947 CAGGCATACTAGGAAGATGTGGG + Intergenic
1090651024 11:128806115-128806137 AATTCTTTCAAGAAAGAGGTTGG + Intronic
1091139948 11:133226453-133226475 CAGGGATACAAGAAAGAGGTTGG - Intronic
1092571878 12:9734308-9734330 CAGTCTTAAGAGACAGAGGTCGG - Intergenic
1095929296 12:47609598-47609620 CTGTCTTACTAGAAAGCAGTGGG - Intergenic
1098856485 12:75658366-75658388 AATTCTTATTACAAAGAGGTAGG - Intergenic
1100438677 12:94595217-94595239 TAATCTTAGTGGAAAGAGGTGGG + Intronic
1101973764 12:109336964-109336986 CACACTTACTAGAAGGAGGGAGG + Intergenic
1103503363 12:121422810-121422832 AAGTCTAACTTGAAAGAGATGGG - Intronic
1105060511 12:133146116-133146138 CAGTAATACGAGAATGAGGTGGG + Intronic
1106042498 13:26106562-26106584 CAGTAGTAGTAGAAAGATGTGGG - Intergenic
1108158399 13:47611960-47611982 AAGGGTTACTAGTAAGAGGTTGG + Intergenic
1108570369 13:51743766-51743788 CAGTTTTACTGGAAAGTGGGAGG + Intronic
1109110496 13:58312989-58313011 AAGTGTTACTAGGAAGAGTTTGG - Intergenic
1110531054 13:76598719-76598741 CAGTTTTAAAAGAAAGAGATGGG - Intergenic
1114295314 14:21324014-21324036 GAGACTTACTGGAAAGAGGTAGG - Intronic
1118278882 14:64410782-64410804 CAGGCCTACTAGAAACATGTGGG - Intronic
1118985847 14:70753995-70754017 CAGTCTCCCTTGAATGAGGTGGG + Intronic
1119409157 14:74418529-74418551 CACTCTTTCTAGGAAGAGTTAGG + Intronic
1122680148 14:103454036-103454058 CAGGTTTAGTAGAAAGAGGATGG + Intronic
1126172796 15:45708189-45708211 GAGTTTTCCAAGAAAGAGGTGGG + Intergenic
1132140031 15:99384768-99384790 CTTTCTTACTAGAGAGAAGTGGG - Intronic
1137660766 16:50204103-50204125 CAGTGTTACCATAAGGAGGTTGG + Intronic
1138560854 16:57800279-57800301 CAGTCTTACTGGGAAGGGGATGG + Intronic
1141934016 16:87224682-87224704 CAGTGTTTCTAGAAAGTGCTCGG + Intronic
1143354249 17:6313581-6313603 CAATAAGACTAGAAAGAGGTGGG + Intergenic
1146234330 17:31144283-31144305 CAGTCTTACTCAAGAGAGGATGG - Intronic
1150318777 17:64192288-64192310 AAGTCATACTAGAAACAGGGTGG + Intronic
1155773893 18:29734854-29734876 CAGTCTTCATAGAATGAGTTAGG + Intergenic
1156925933 18:42579062-42579084 CAGTCTTAAGAGAAAGATATGGG - Intergenic
1160055883 18:75480008-75480030 CTGTCTTACTTGAAGGAGATGGG - Intergenic
1160155763 18:76432729-76432751 CAGGCTTCCTAGAGAGAGGTTGG - Intronic
927028814 2:19099309-19099331 CAGACTTACTGGAGAGAGATGGG - Intergenic
930544967 2:52755747-52755769 TATTCTTATTAGAAATAGGTTGG - Intergenic
932264443 2:70355082-70355104 CAGTCTTACAGGACAGAGGGTGG - Intergenic
935653946 2:105405737-105405759 TAGTCTAACTAGAAAGAGCCTGG + Intronic
938686049 2:133738939-133738961 CAGAGTTACTAAAAAGAGGTTGG - Intergenic
938726513 2:134113424-134113446 CAGTCTTGCTGGAGAGAGGCTGG + Intergenic
940048704 2:149437813-149437835 CAGTCTTACTTGAAGGATGGAGG - Exonic
940065037 2:149618035-149618057 CAGACTTAATAGAAAAAGATTGG - Intergenic
945043221 2:205759889-205759911 CAGTCTTACTGCATAGAGTTGGG - Intronic
1169588502 20:7114228-7114250 CAGTCTTATGAGGAAGAGTTAGG - Intergenic
1173037667 20:39428151-39428173 CAGTCTTCCTACTTAGAGGTGGG + Intergenic
1173943749 20:46933648-46933670 AAGTCTCACTAGAACGAGGGAGG + Intronic
1177259286 21:18708212-18708234 CATCCTTACTAGAATGAGGAAGG + Intergenic
1182133334 22:27876095-27876117 CAGTCTGACGAGGAAGTGGTAGG + Intronic
951230917 3:20178945-20178967 CAGTCTGAATTGAAAGAGGCCGG + Intronic
952168354 3:30776722-30776744 CAGTCTAACTAGAAGGAAGAGGG - Intronic
952600133 3:35070200-35070222 CAATCTTGATAGAAAGAGATTGG + Intergenic
954194567 3:48989105-48989127 AAATCTTAGAAGAAAGAGGTGGG + Intergenic
954608146 3:51929540-51929562 CAGTGTCCCCAGAAAGAGGTGGG + Intergenic
956541554 3:70345396-70345418 CAGTCTCACTTGAAAGTGTTGGG - Intergenic
956646352 3:71460985-71461007 CAGTTTTACAATAAAGAGATGGG + Intronic
958782040 3:98554358-98554380 CAGTCTTACTTGGAAGTGGAAGG - Intronic
960525831 3:118708685-118708707 CAGCCATAAAAGAAAGAGGTTGG + Intergenic
962226262 3:133612590-133612612 CATTTTTCCTAGAAAGAAGTTGG - Intronic
962469637 3:135694545-135694567 CAATGCTATTAGAAAGAGGTAGG - Intergenic
965292513 3:166901559-166901581 CAGTCTGAATTAAAAGAGGTTGG - Intergenic
965395876 3:168160078-168160100 AAGTCTTAAAAGAAAGAGGCAGG + Intergenic
967429375 3:189363905-189363927 CTGTCTTACTTGGGAGAGGTTGG - Intergenic
972566540 4:40274497-40274519 CAGTTTTAGCAGAAAGATGTTGG + Intergenic
973062226 4:45741941-45741963 CAGTCTTTCTGGAAGGAGTTTGG - Intergenic
973217213 4:47682789-47682811 CTGTGTGACTAGATAGAGGTGGG - Intronic
973613748 4:52659532-52659554 CAGTCCGAATAGAAAGAGGCAGG - Intergenic
973902119 4:55486354-55486376 CAGTCCCAATAGAAACAGGTTGG - Intronic
974760459 4:66267025-66267047 CAATCTTACTAGCATCAGGTTGG + Intergenic
980744596 4:136998908-136998930 CAATCCTACTAGCATGAGGTTGG - Intergenic
981272844 4:142864874-142864896 AAGGCGCACTAGAAAGAGGTGGG + Intergenic
984159390 4:176232755-176232777 TAGTCTTAAGAGAAAGATGTTGG - Intronic
987432176 5:17848239-17848261 CAGTCCTTCTAGAGAGAGGAAGG + Intergenic
988040479 5:25882881-25882903 CCGTCTTACAAGAAAAAGGCCGG - Intergenic
989138894 5:38182529-38182551 CAGACTTAGTAGAAAGAGCATGG + Intergenic
990361322 5:55023179-55023201 CAGTGTTACTAGGAAGTGATTGG + Intergenic
993258656 5:85628242-85628264 CAGGCTTTCTAGTAACAGGTGGG + Intergenic
993746109 5:91598938-91598960 CAGTCTTAGAAGAATGAGGTGGG - Intergenic
995407166 5:111811448-111811470 AAGTCTTCGTTGAAAGAGGTGGG - Intronic
996159581 5:120145989-120146011 CACTCTTACTACGAAGAGGCTGG - Intergenic
997070718 5:130619109-130619131 CAGTCCTAATAGAAGGAGCTGGG + Intergenic
999388172 5:151170472-151170494 CAGACATTCTAGGAAGAGGTTGG + Intergenic
1002555557 5:180036300-180036322 CAGTCTTATTAAAAAGAAGGAGG - Intronic
1003439204 6:6123701-6123723 TAATCTCACTAGAAAGTGGTTGG - Intergenic
1004658998 6:17693307-17693329 CAGTCTTACCAGAAACCAGTTGG - Intronic
1005283733 6:24302504-24302526 CAGTCTTAAGAGAAAAGGGTGGG - Intronic
1010891207 6:81313012-81313034 CATTCTTTCTGGAAAGAGTTTGG + Intergenic
1013451214 6:110283186-110283208 TAGTCTTGTTAGGAAGAGGTGGG - Intronic
1013644876 6:112127291-112127313 CAGTATTACTGGTAGGAGGTAGG + Intronic
1014543863 6:122709451-122709473 CATTCTTAGTACAAAGAGATGGG + Intronic
1015468613 6:133576684-133576706 TACTCTTCCAAGAAAGAGGTTGG + Intergenic
1015873967 6:137803932-137803954 CAGTTTTACCAGAAATAGTTTGG + Intergenic
1015957860 6:138616760-138616782 CAGTCTTGATAGGAGGAGGTAGG - Intronic
1015971553 6:138747611-138747633 AAATCTGACTAGAAAGAGGTGGG + Intergenic
1016133210 6:140503231-140503253 CAGAGTAAATAGAAAGAGGTGGG + Intergenic
1017389082 6:153918862-153918884 CATTCTAATTAGAAAGAGGGGGG - Intergenic
1021154453 7:17193006-17193028 GAGTCTTGCTAGTAAGAAGTGGG - Intergenic
1023544884 7:41308104-41308126 CAGTCCTAGTAGAAAGAGTTTGG - Intergenic
1025112167 7:56227126-56227148 CAAGCTTACTATAAAGATGTGGG - Intergenic
1025264835 7:57448057-57448079 GAGTTTTACAAGAAAGGGGTGGG + Intergenic
1025634069 7:63306133-63306155 GAGTTTTACAAGAAAGACGTGGG - Intergenic
1025648629 7:63442034-63442056 GAGTTTTACAAGAAAGACGTGGG + Intergenic
1025741975 7:64205027-64205049 GAGTTTTACAAGAAAGGGGTGGG + Intronic
1027126382 7:75559604-75559626 CTGTCTTTCTAGAAACAGCTAGG - Intronic
1028124336 7:87094678-87094700 AAATCATACGAGAAAGAGGTGGG - Intergenic
1028668962 7:93379014-93379036 TAGTCATTCTGGAAAGAGGTAGG - Intergenic
1029210463 7:98904104-98904126 CAGGAGTACTGGAAAGAGGTTGG - Intronic
1031160531 7:118162059-118162081 CAGTCTTAGAGGAAAGAGGGAGG + Intergenic
1032677610 7:134145704-134145726 CTGACTTACTGGAAAGATGTGGG - Intronic
1042434829 8:68751497-68751519 GAGTCTTAATAGAAAAATGTAGG + Intronic
1044935240 8:97287640-97287662 CACTCTTAAGAGAAAGAGGCTGG + Intergenic
1046071343 8:109258484-109258506 CAGTCTCCCTAGGAAAAGGTTGG + Intronic
1046904735 8:119560275-119560297 CAGTCTTATTAGAAACTTGTAGG - Intronic
1051024077 9:12585316-12585338 CAGCCTCACTAGAAACAGATGGG - Intergenic
1051333605 9:16047000-16047022 CATGCTTACTAGAAAGCAGTAGG - Intronic
1053145275 9:35707602-35707624 CAGTCTGAATAGAAAGAGCTTGG + Intronic
1056237643 9:84611005-84611027 CATTCTTCCCATAAAGAGGTAGG - Intergenic
1191663363 X:63672886-63672908 CAGACTTACTAGAAAATTGTGGG - Intronic
1195666250 X:107433742-107433764 TTGTCTTCCTAGAAAGAGGGAGG - Intergenic
1200412323 Y:2872994-2873016 CAGTCTTACTAGAAAGAGGTTGG + Intronic
1201698742 Y:16856566-16856588 CACTCATACTAGAAAGATGCTGG - Intergenic
1202057811 Y:20853777-20853799 CACTCCTACTAAACAGAGGTTGG - Intergenic