ID: 1200415209

View in Genome Browser
Species Human (GRCh38)
Location Y:2902819-2902841
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 19, 1: 37, 2: 31, 3: 22, 4: 129}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200415209_1200415212 8 Left 1200415209 Y:2902819-2902841 CCAGCACTCCCTCAACATAGGGA 0: 19
1: 37
2: 31
3: 22
4: 129
Right 1200415212 Y:2902850-2902872 ACAAATTTTCCTTTGTTTTATGG 0: 26
1: 17
2: 18
3: 83
4: 931

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200415209 Original CRISPR TCCCTATGTTGAGGGAGTGC TGG (reversed) Intronic
900781190 1:4618050-4618072 TCCTTATCTTGAGTGGGTGCTGG + Intergenic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
904344393 1:29858433-29858455 TGCCAAGGTTGAGGGTGTGCTGG + Intergenic
907286973 1:53386951-53386973 TCCCTATCTTGTGTGAGTCCAGG - Intergenic
909742376 1:79045833-79045855 TCCTTATGATACGGGAGTGCTGG - Intergenic
910636091 1:89409629-89409651 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
914927950 1:151905650-151905672 TCCTTTTGTTGAGGGAGTGCTGG - Intronic
915054964 1:153119856-153119878 TCCCTGTGTTGAAAGAGTGCTGG + Intergenic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
916527883 1:165628825-165628847 TCCCTATGTGGAGGGAGTGCTGG + Intergenic
919437559 1:197580860-197580882 TCCTTATGTTGAGACAGTACAGG - Intronic
919728593 1:200899216-200899238 GACCTATGGTGGGGGAGTGCAGG - Intronic
921554196 1:216577211-216577233 TCCCTATGTTCAGCAAATGCAGG - Intronic
922331953 1:224585295-224585317 TACGTATGTTGAGTGATTGCGGG - Intronic
1068389132 10:56370462-56370484 TCCTAATGTTAAGGGAGTGCTGG - Intergenic
1073390776 10:103174572-103174594 TTCTTTTTTTGAGGGAGTGCTGG - Intronic
1073803894 10:107074199-107074221 GCCCGGTGTTGGGGGAGTGCAGG - Intronic
1073927518 10:108534127-108534149 TCGCTATGTTGGGGAAGTTCTGG - Intergenic
1074448201 10:113537771-113537793 TGCCTGGGTTGAGGGAGGGCAGG - Intergenic
1075026700 10:118990169-118990191 TCCCAAAGTTGCGGGATTGCAGG + Intergenic
1075161635 10:120029578-120029600 TCTCTCTGTTGAGGCAGGGCAGG - Intergenic
1075444196 10:122502561-122502583 TCCCTCTGTTGAGAGACTTCTGG + Intronic
1076836001 10:133021220-133021242 GCCCTGGGTTGAGGGAGGGCTGG + Intergenic
1077001109 11:322757-322779 TCCCTGTGTTAAGGGAGTGCTGG + Intronic
1079816964 11:25073398-25073420 TCCCTGTGTGGAGGAAGTGCTGG + Intronic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1082960885 11:58917796-58917818 TCCCTTTGTGGAGGGAATGCTGG + Intronic
1083300748 11:61738590-61738612 TCCCTAGGCTCAGGGAGGGCTGG + Intronic
1084679187 11:70656139-70656161 GCCCCATGTTGTGGGAGTGAAGG + Intronic
1087032212 11:93717008-93717030 TCCCTATGTTGAAGGAGTGCTGG + Intronic
1087871257 11:103295458-103295480 TCCCTAAGTTGAGGGAGTGCTGG - Intronic
1090624555 11:128594642-128594664 TGGCTATGTTGAGGGAGTAAGGG - Intergenic
1094348151 12:29494392-29494414 TACCTGTGTTGAGAGAGTGTTGG + Intronic
1095554111 12:43480788-43480810 TCCACATGCTGAGGGAGTGTGGG + Intronic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1096924106 12:55123110-55123132 TCCCTAAGTTCAGGCAGTGATGG - Intergenic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1098405580 12:70122983-70123005 TCCCTCTGTGGATGGGGTGCTGG - Intergenic
1099799190 12:87435728-87435750 TTACTTTGTTGAGTGAGTGCTGG - Intergenic
1103340051 12:120216359-120216381 GCCCCATGATGAGGGGGTGCAGG - Intronic
1103380153 12:120487940-120487962 TCCCTATGTTGAGGGAGTACTGG + Intronic
1104630546 12:130397758-130397780 TCTCTGTCTCGAGGGAGTGCGGG + Exonic
1104722585 12:131053205-131053227 TCACTGTGATGACGGAGTGCAGG + Intronic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1108337790 13:49463826-49463848 TCTCTATGTTGAGGGAGTGCTGG + Intronic
1109270018 13:60245510-60245532 TCCCTATGTGAAGGGAGTAGTGG + Intergenic
1109404146 13:61875595-61875617 TCGCTATGTTGAGGGAATGCTGG + Intergenic
1109487402 13:63045043-63045065 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1109782525 13:67130664-67130686 TTCCTATGATGAGGCAGTTCTGG - Intronic
1109782530 13:67130705-67130727 TTCCTATGATGAGGCAGTTCTGG - Intronic
1109997975 13:70154684-70154706 TCTCTTTGTTGAGGGATTGCTGG - Intergenic
1113275526 13:108725184-108725206 TCCCTATGTTCAGAAAGTGAGGG - Intronic
1113987242 13:114328036-114328058 TGCCTCACTTGAGGGAGTGCTGG + Intergenic
1114325347 14:21583295-21583317 TCCCAATGTGGAGGGATTACAGG + Intergenic
1115632613 14:35260406-35260428 TCCTTATGTTGAGGGAGTACTGG - Intronic
1116395984 14:44449209-44449231 TCCTTATGTTGAGGGAGTGTTGG + Intergenic
1116581392 14:46646685-46646707 TCCATATTTTGAGAGATTGCAGG + Intergenic
1117477966 14:56116914-56116936 TCCCTTTAGTGAAGGAGTGCTGG + Intergenic
1118647035 14:67850641-67850663 TTCCTATTTTACGGGAGTGCTGG + Intronic
1119436265 14:74599811-74599833 TGCCCATGCTCAGGGAGTGCTGG - Intronic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1120789301 14:88564059-88564081 TCCCTAGGTGCTGGGAGTGCGGG + Intronic
1122299262 14:100722814-100722836 TCCCTGTGTTGAGGGCTTACAGG - Intergenic
1122647539 14:103205378-103205400 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1123218635 14:106836579-106836601 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1123220007 14:106845812-106845834 TCCTTATGCTGAGGGAGTGCTGG + Intergenic
1127627332 15:60793011-60793033 TCTCTCTTTTGAGGGAGTGGTGG - Intronic
1128600568 15:68992161-68992183 TCCTTATGTTGAGGGAGTGCTGG + Intronic
1129018260 15:72488982-72489004 TCCCAAAGTTGTGGGATTGCAGG - Intronic
1129124678 15:73428663-73428685 TCCCAAAGTTGAGGGATTACAGG + Intergenic
1129981769 15:79878709-79878731 TCCCTATGTGGAGGGAGTGGTGG + Intronic
1132697371 16:1207940-1207962 TCCCTAGGTTGGGGGATTCCTGG + Intronic
1133208854 16:4251437-4251459 TCCCAAAGTTGTGGGATTGCAGG - Intergenic
1137575140 16:49594384-49594406 TCCCTCTGTTGAGAGAGGCCTGG - Intronic
1139736212 16:68991113-68991135 TCCCTCTGTTGAGGCTGTGTTGG + Intronic
1141764939 16:86052020-86052042 TGCTTGTGTTGAGGGTGTGCAGG + Intergenic
1143131269 17:4678994-4679016 TCCCTCTGTTGAGGGTGTTGAGG - Intronic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1145361109 17:22213165-22213187 TCCCAATGTTGAGGGAGTGCTGG - Intergenic
1146387349 17:32389070-32389092 TCCCTCTCTTGAGGGGGAGCTGG - Intergenic
1146559309 17:33854567-33854589 TCCCTACTTTGAGGGAATCCTGG - Intronic
1147184510 17:38705956-38705978 ACCCTAAGTTGAGGGAGTTTGGG + Intronic
1148335478 17:46838047-46838069 CCCCTGTGTTGAGGGGGTGGAGG + Intronic
1150301786 17:64053269-64053291 CACCGATGTTGAGGGAGTGGAGG + Exonic
1150814457 17:68381880-68381902 TCCCTAGGTTTAGTGAGTGAGGG + Intronic
1151923513 17:77175701-77175723 TCCCTGTGTTGAGGGAGTGCTGG + Intronic
1203165616 17_GL000205v2_random:90264-90286 TCCCTGTGTTGGGGGAGTGTTGG + Intergenic
1153992785 18:10414842-10414864 GCTCTATGATGAGGGAATGCTGG - Intergenic
1155532607 18:26782358-26782380 TTCCAAGGTTGAGGGAGTTCAGG + Intergenic
1155732701 18:29180717-29180739 TCCGTATGTTGAGGGAATGCTGG + Intergenic
1155823518 18:30408708-30408730 TCCCTATGTTTAGGAAGTGCTGG - Intergenic
1156953358 18:42932124-42932146 TTTCTATCATGAGGGAGTGCTGG - Intronic
1159054777 18:63452762-63452784 TCCCTATGTTGAAGGAGTGCTGG - Intergenic
1160786263 19:901384-901406 TCCCCGTGTGGAGGGAGTGAGGG + Intronic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1163680956 19:18682306-18682328 TCCCTCTCTTGAGGGAGGGAGGG + Intergenic
1164044060 19:21519279-21519301 TCCCTATGTTGAGGGAATGCTGG - Intronic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1165638722 19:37365635-37365657 TCCTTATGTTGAGGGAGTGCTGG + Intronic
1165705231 19:37971237-37971259 TCCCTAAGTGCTGGGAGTGCAGG + Intronic
1165803516 19:38566904-38566926 TCCCTAGGTGGATGGAGTGGAGG + Exonic
1166246812 19:41534199-41534221 TCCCTACATTGAAGGAGTGCTGG + Intergenic
1167496281 19:49820597-49820619 TCTCTATGTTGAGGGAGTGCTGG + Intronic
1168403010 19:56096939-56096961 TCCCGATGTTGAGAGGGTGAGGG - Intronic
925180156 2:1812387-1812409 TCCCCATGATGGGAGAGTGCTGG + Intronic
927132717 2:20073982-20074004 TCCCTATGTTGAGGGAGGGCTGG - Intergenic
930016947 2:46977240-46977262 TATCTAAGTTGAGGGAGGGCAGG + Intronic
932651349 2:73561334-73561356 TCCCTGTGTTGAAGGAGTGCTGG + Intronic
933083890 2:78030079-78030101 TCCTTATGTTGTGGGAGTGCTGG + Intergenic
933532744 2:83531092-83531114 TCCCTCTGTAGAGGGAGTGCTGG - Intergenic
937607181 2:123815156-123815178 TCCCAAAGTTCTGGGAGTGCTGG - Intergenic
937944152 2:127316112-127316134 TCCCAATGTCGTGGGATTGCAGG - Intronic
938251684 2:129820777-129820799 TCCCTGTGTTGAGGGAGTCCTGG + Intergenic
942903839 2:181157068-181157090 TCCCAATGTTGAAGGAGGCCTGG - Intergenic
947567942 2:231207264-231207286 TCCCAAAGTTGTGGGATTGCAGG + Intronic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
949052890 2:241906714-241906736 TCCCTATATTGAGGGAGTGCTGG + Intergenic
1168788639 20:561071-561093 TCCACATAATGAGGGAGTGCTGG - Intergenic
1168831487 20:847465-847487 TCCCCATGCTGAAGGAGTGATGG + Intronic
1171286765 20:23946095-23946117 TCCCTATGTCCAGGGTGTCCAGG + Intergenic
1173679081 20:44863619-44863641 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
1173943960 20:46935167-46935189 TTGCTATGTAGAGTGAGTGCAGG + Intronic
1175039414 20:56032861-56032883 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1176335991 21:5600717-5600739 TCCCGATGTTGGGGGAGCGTTGG - Intergenic
1176391766 21:6220231-6220253 TCCCGATGTTGGGGGAGCGTTGG + Intergenic
1176406138 21:6368815-6368837 TCCCTGTGTTGGGGGAGTGTTGG - Intergenic
1176469653 21:7095943-7095965 TCCCGATGTTGGGGGAGCGTTGG - Intergenic
1176493214 21:7477721-7477743 TCCCGATGTTGGGGGAGCGTTGG - Intergenic
1176507428 21:7660662-7660684 TCCCGATGTTGGGGGAGCGTTGG + Intergenic
1176687636 21:9865287-9865309 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
1177836048 21:26187304-26187326 TCCCAAAGTTCAGGGATTGCAGG + Intergenic
1178677204 21:34641340-34641362 TTTCTATGTTGAGGGAGTGCTGG - Intergenic
1179776915 21:43670567-43670589 TGCCTCTGTAGAGGGAGAGCAGG + Intronic
1180894164 22:19316210-19316232 TCCTTATGTGGAGGGAGTGCTGG - Intergenic
1181742471 22:24932489-24932511 CCCCAAAGTTGAGGGGGTGCTGG - Intergenic
950706269 3:14784388-14784410 TCCCTAGGTTTAGGGGCTGCTGG + Intergenic
952107110 3:30083634-30083656 TCCTTCTGGTGAGGCAGTGCTGG - Intergenic
953980353 3:47410336-47410358 TCCCTATGTGGGGGTAGGGCCGG + Exonic
959961255 3:112302004-112302026 TCCCTGTGTTGAGGGGGTGCTGG - Intergenic
959962002 3:112308059-112308081 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
959962313 3:112312426-112312448 TCCTTATGTTGAGAGAGTGCTGG - Intergenic
961305156 3:125953783-125953805 TCCCTCTGCTGAAGGAGGGCGGG + Intergenic
961317765 3:126052264-126052286 ACCCTATGTGGAGGGTGTGCAGG - Intronic
964690554 3:159444879-159444901 ACCTGATGTTGAGGGAGTGAAGG + Intronic
964691648 3:159456301-159456323 TCTCTATGTTGAGGGAATGATGG + Intronic
965850194 3:173013860-173013882 TCCCTAGGTTGAGGGAGTGCTGG + Intronic
966559002 3:181297858-181297880 TGCCTGTGTGGAGGGAGGGCAGG - Intergenic
967305393 3:188054008-188054030 TCCCTATGTGGACGGAGAACAGG - Intergenic
968692284 4:1998740-1998762 TCTCTAGGTTGAGGAAGTTCTGG - Intronic
969833980 4:9823910-9823932 TGCTTATGTTGGGGGAGTGAAGG + Intronic
971278853 4:25224407-25224429 TCCTTATGTTGAGGGAGTGCTGG + Intronic
972597497 4:40542793-40542815 TCCCTATGTGCTGGGATTGCAGG + Intronic
972651754 4:41024631-41024653 TCCCTATGTTGAAGGAGGGCTGG - Intronic
974989277 4:69064290-69064312 TCCCTATGTTGAAGGAGTTTTGG - Intronic
975048777 4:69832919-69832941 TCTCTATATTGAGGGAGTGCTGG + Intronic
975894992 4:79078472-79078494 TTCCCATGTTGAGGCAGTTCTGG + Intergenic
977919031 4:102623904-102623926 TTCATTTGTTGAGGGAATGCTGG - Intergenic
978533346 4:109736183-109736205 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
980350988 4:131683103-131683125 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
980822972 4:138040145-138040167 TCCATCTGATGATGGAGTGCTGG + Intergenic
982819281 4:159926446-159926468 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
986807856 5:11325840-11325862 CTCCTATGTTGAAGGAATGCTGG - Intronic
987714867 5:21554904-21554926 TCCATGTGTTGAAGGAGTGCTGG + Intergenic
989758360 5:44983678-44983700 TTCTTATGTTCAGGGAGTGCTGG + Intergenic
992759559 5:79939455-79939477 TCCATATCTTGAGGGATTGCAGG - Intergenic
993516411 5:88841249-88841271 TCCCAAAGTTCAGGGAGTGCAGG - Intronic
998770319 5:145536551-145536573 TTCCTATGTGGAGGGAAAGCTGG + Intronic
1002081191 5:176738452-176738474 TCCCCATGGTGAGGGTGTGAGGG + Intergenic
1002761820 6:208393-208415 TCCCCATGTTGTGTGAGAGCAGG - Intergenic
1003213976 6:4091954-4091976 TCGCTATGTTGAGGGAGTGCTGG - Intronic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1003849658 6:10208872-10208894 TCTCTATGTTGAAGGAGAGTGGG - Intronic
1004603193 6:17170418-17170440 TCCCTGTGCTGAGGGAGTGAAGG + Intergenic
1005423301 6:25675158-25675180 TCCCTTTGTTGAGGGAGTGCTGG - Intronic
1005808155 6:29494361-29494383 TCCCTAGGATGAGGGAGTCAGGG - Intergenic
1006296907 6:33173804-33173826 TCAGGATGTTGAGGGAGAGCTGG + Intronic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1007623042 6:43226393-43226415 CCCCTGTGTTGAGGGAAAGCTGG + Exonic
1011504960 6:88031282-88031304 TCCTTATTTTGAGAGAGTGCTGG - Intergenic
1011550501 6:88527474-88527496 TCCCAATGCTGAGGGAGGGAAGG + Intergenic
1012187476 6:96237314-96237336 TCCCTGTGTTGAGGGAAGGTGGG - Intergenic
1012820296 6:104078416-104078438 TCCCTATGTGCTGGGAGTACAGG + Intergenic
1014519437 6:122422818-122422840 TCCCTAAGTTCAGGCAGTGATGG + Exonic
1015806968 6:137119458-137119480 TCCCAAGGTTGAGGGAGTGCTGG - Intergenic
1017091954 6:150767129-150767151 TCTTTATTTTGAGGGAGTGTAGG + Intronic
1018838355 6:167501649-167501671 TCACTATGTTGAGGGAGAGAAGG + Intergenic
1019897345 7:3992505-3992527 TCCCTGCATTGAGAGAGTGCAGG + Intronic
1020222968 7:6255601-6255623 TCCCTATCTTGATGAGGTGCTGG - Intronic
1022136903 7:27457543-27457565 TTCCTATTTAGAGGGAGTCCTGG - Intergenic
1022674064 7:32481929-32481951 TCCGTATGTTGAGGGAATGCTGG - Intergenic
1024423614 7:49199979-49200001 TCTGTATGTTGAGGGAGTGCTGG - Intergenic
1025752715 7:64307305-64307327 TCCCTAGGTTGCAGGACTGCAGG - Intergenic
1026926238 7:74195906-74195928 TTCCTATTTAGAGGGAGTCCTGG + Exonic
1032670497 7:134077950-134077972 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1032720400 7:134546784-134546806 CCCCTAGGTTGAGGGAGATCAGG + Intergenic
1032871495 7:135990905-135990927 TTTCCATGTTGATGGAGTGCAGG - Intergenic
1033106294 7:138528335-138528357 TCCCCATGTTGGGGGAGTGCTGG + Intronic
1033714805 7:143989221-143989243 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
1039500578 8:38013574-38013596 TCCCTATGTTGAGGAAGTGCTGG + Intergenic
1039839200 8:41281363-41281385 CCCCCATGCTGAGGGAGTGAGGG - Intronic
1040063497 8:43125013-43125035 TCCCTATGTTGAGGAAGTGCTGG + Intergenic
1040607566 8:48949631-48949653 TCCCTAGGTTCAGGTAGAGCTGG - Intergenic
1041400856 8:57443210-57443232 TCCCTATGTTGCCAGAGTGCTGG + Intergenic
1041507350 8:58614285-58614307 TCCCTATGTTAAAGGAGTGCTGG - Intronic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1046658656 8:116924768-116924790 TCCCTGTGTTGAGGGAGTGCTGG + Intergenic
1047398826 8:124528798-124528820 TCCTTATGTTGAGGGAGTGCTGG - Intronic
1053414928 9:37941500-37941522 TCCCTCTGTTGGGGGAGTCATGG + Intronic
1053781720 9:41616612-41616634 TCCCTATGTTGAGGGAGCGCTGG + Intergenic
1054169668 9:61826766-61826788 TCCCTATGTTGAGGGAGCCCTGG + Intergenic
1054667870 9:67754049-67754071 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
1055093364 9:72385466-72385488 TTAGTATGTTGAGGGAGTTCAGG - Intergenic
1055323362 9:75103640-75103662 TCCCTCTGTTGCTAGAGTGCTGG + Intronic
1056578648 9:87874182-87874204 TCCTTATGTTGAGGGAGTGCTGG - Intergenic
1057414048 9:94845728-94845750 GCCATTTGTTGAGGGAGGGCTGG + Intronic
1060097519 9:120805362-120805384 TCCTGATGTTGAGGGAGTGCTGG + Intergenic
1061825848 9:133257735-133257757 GTCCAATGTTGAGGGAGGGCTGG - Intronic
1061840041 9:133353379-133353401 GCCCTACCTTGAGGGAGTGGAGG - Intronic
1062570342 9:137182090-137182112 TCCCTATGTGCTGGGATTGCAGG - Intronic
1203425647 Un_GL000195v1:34185-34207 TCCCGATGTTGGGGGAGCGTTGG + Intergenic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1189852993 X:45195383-45195405 ACCCTATGTTGAGGGACTTGGGG - Intronic
1190413059 X:50156154-50156176 TCCCTATGGTGTCGGTGTGCAGG + Intergenic
1190535046 X:51417646-51417668 TCCTTACGTTGAGGGAGTGCTGG + Intergenic
1191645369 X:63474910-63474932 TCCTTATGTTGAGGGAGTGCTGG - Intergenic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1193809109 X:86030676-86030698 TCCCTCTGTAGAGGGAGTCATGG + Intronic
1197360224 X:125492637-125492659 TCCTTATGTTGAGAGAGTGCTGG - Intergenic
1197787740 X:130216738-130216760 TCCCAAAGTTCAGGGAGTACAGG - Intronic
1199440077 X:147857822-147857844 TCCCAATGTTGAGGGAGACCCGG - Intergenic
1199745642 X:150770617-150770639 GCCCTATGAGGATGGAGTGCCGG - Intronic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1201147566 Y:11073206-11073228 TCTCCATGTTGAGGGCGTGGCGG - Intergenic
1201264905 Y:12196680-12196702 TCTGTATGCTGAGGGAGTGCTGG - Intergenic
1201428291 Y:13878603-13878625 TCCCTATATTGAGGGAGTGCTGG + Intergenic
1202237472 Y:22728550-22728572 TCCCTGCGTTGAGGGTGTGCTGG - Intergenic