ID: 1200415621

View in Genome Browser
Species Human (GRCh38)
Location Y:2906915-2906937
Sequence AAAAATAAGGAGAAGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2186
Summary {0: 1, 1: 2, 2: 21, 3: 224, 4: 1938}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200415621_1200415626 22 Left 1200415621 Y:2906915-2906937 CCAGCCTCCTTCTCCTTATTTTT 0: 1
1: 2
2: 21
3: 224
4: 1938
Right 1200415626 Y:2906960-2906982 TGCCCATCACTCTGTTGCAGTGG 0: 1
1: 0
2: 1
3: 8
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200415621 Original CRISPR AAAAATAAGGAGAAGGAGGC TGG (reversed) Intronic
Too many off-targets to display for this crispr