ID: 1200418259

View in Genome Browser
Species Human (GRCh38)
Location Y:2935454-2935476
Sequence CCGCGTGCCCCCGCGGCCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 4, 3: 22, 4: 252}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200418253_1200418259 -1 Left 1200418253 Y:2935432-2935454 CCGCACATCCGTCGGGTGAGTCC 0: 1
1: 0
2: 1
3: 3
4: 38
Right 1200418259 Y:2935454-2935476 CCGCGTGCCCCCGCGGCCGCGGG 0: 1
1: 0
2: 4
3: 22
4: 252
1200418246_1200418259 19 Left 1200418246 Y:2935412-2935434 CCGCCGCTGTCGCCGACCGCCCG 0: 1
1: 0
2: 0
3: 24
4: 157
Right 1200418259 Y:2935454-2935476 CCGCGTGCCCCCGCGGCCGCGGG 0: 1
1: 0
2: 4
3: 22
4: 252
1200418251_1200418259 3 Left 1200418251 Y:2935428-2935450 CCGCCCGCACATCCGTCGGGTGA 0: 1
1: 0
2: 1
3: 1
4: 21
Right 1200418259 Y:2935454-2935476 CCGCGTGCCCCCGCGGCCGCGGG 0: 1
1: 0
2: 4
3: 22
4: 252
1200418248_1200418259 7 Left 1200418248 Y:2935424-2935446 CCGACCGCCCGCACATCCGTCGG 0: 1
1: 0
2: 0
3: 6
4: 33
Right 1200418259 Y:2935454-2935476 CCGCGTGCCCCCGCGGCCGCGGG 0: 1
1: 0
2: 4
3: 22
4: 252
1200418254_1200418259 -9 Left 1200418254 Y:2935440-2935462 CCGTCGGGTGAGTCCCGCGTGCC 0: 1
1: 0
2: 1
3: 1
4: 37
Right 1200418259 Y:2935454-2935476 CCGCGTGCCCCCGCGGCCGCGGG 0: 1
1: 0
2: 4
3: 22
4: 252
1200418244_1200418259 29 Left 1200418244 Y:2935402-2935424 CCTGCAGCACCCGCCGCTGTCGC 0: 1
1: 0
2: 4
3: 27
4: 263
Right 1200418259 Y:2935454-2935476 CCGCGTGCCCCCGCGGCCGCGGG 0: 1
1: 0
2: 4
3: 22
4: 252
1200418245_1200418259 20 Left 1200418245 Y:2935411-2935433 CCCGCCGCTGTCGCCGACCGCCC 0: 1
1: 0
2: 1
3: 15
4: 160
Right 1200418259 Y:2935454-2935476 CCGCGTGCCCCCGCGGCCGCGGG 0: 1
1: 0
2: 4
3: 22
4: 252
1200418252_1200418259 0 Left 1200418252 Y:2935431-2935453 CCCGCACATCCGTCGGGTGAGTC 0: 1
1: 0
2: 1
3: 0
4: 36
Right 1200418259 Y:2935454-2935476 CCGCGTGCCCCCGCGGCCGCGGG 0: 1
1: 0
2: 4
3: 22
4: 252
1200418247_1200418259 16 Left 1200418247 Y:2935415-2935437 CCGCTGTCGCCGACCGCCCGCAC 0: 1
1: 0
2: 1
3: 5
4: 77
Right 1200418259 Y:2935454-2935476 CCGCGTGCCCCCGCGGCCGCGGG 0: 1
1: 0
2: 4
3: 22
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200418259 Original CRISPR CCGCGTGCCCCCGCGGCCGC GGG Intronic
900318004 1:2069022-2069044 CCACGTGTCCCCGTGGCAGCCGG - Intronic
900384473 1:2403488-2403510 CCGCCTTCCCCAGCAGCCGCAGG + Exonic
901109643 1:6784953-6784975 CCGCGTGCTCCCGGGGCTGAAGG - Intergenic
901109783 1:6785472-6785494 CCTCGTACCGCCGCCGCCGCCGG - Exonic
901272225 1:7961489-7961511 CGGCCTGCCCCGGCGCCCGCGGG - Intronic
902870739 1:19312277-19312299 CCGCGCGCCACCGCCCCCGCGGG - Intergenic
903329297 1:22588982-22589004 CCGTGTGCCGCCGCTGCCCCTGG + Exonic
903398408 1:23020008-23020030 CCGCCCTCCCCCGCCGCCGCCGG + Intronic
903420848 1:23217191-23217213 CCCCGGGCCCCCGAGGCCCCAGG + Intergenic
903813188 1:26046121-26046143 CCGCTGCGCCCCGCGGCCGCCGG + Exonic
904181396 1:28668986-28669008 GTGCGTGCCGCCGCCGCCGCCGG + Intronic
906047883 1:42846674-42846696 CCGCCTCCCCCCGCGACCTCGGG - Intronic
906640574 1:47438430-47438452 CCGCGGGCCGCCGCGGCGCCTGG - Exonic
906650359 1:47508451-47508473 CCTGGGGCCGCCGCGGCCGCAGG + Intergenic
907189072 1:52633556-52633578 CCGCCTCGCCCCCCGGCCGCGGG - Exonic
908132106 1:61083541-61083563 GCGCGTTCCCCCGCGCCGGCCGG + Intronic
911188295 1:94925656-94925678 CCGCCTACCCCCGCAGCCCCGGG + Intronic
912360430 1:109090584-109090606 CTGCGTGCCCCTGCGGGCGTAGG - Exonic
913450179 1:118987819-118987841 CCGCTTGCCCCCGCTACCGAGGG + Intronic
915359511 1:155277672-155277694 CCGCCTGCGACCGCGGCCTCAGG + Exonic
921604757 1:217139698-217139720 CCGCGCACCGCCGCCGCCGCCGG - Intergenic
922739419 1:228007004-228007026 ACCCGCGCACCCGCGGCCGCAGG + Intergenic
922753535 1:228082155-228082177 CCGCGCGTCACTGCGGCCGCCGG + Intergenic
923055886 1:230425902-230425924 CCGCGCGCCCCCGCCGCCCTCGG + Intergenic
923639309 1:235737932-235737954 CCGCGTGCCCCAACACCCGCCGG + Intronic
924172416 1:241356678-241356700 CCCCGCGCCGCGGCGGCCGCCGG + Intronic
924436899 1:244049500-244049522 GCGCGAGCCCCCGGGGCCTCCGG - Intronic
924729288 1:246697139-246697161 GAGCGTGGCCCAGCGGCCGCAGG + Intergenic
1062854705 10:774092-774114 CCCCGTGCCCCCGAGGCAGGAGG + Intergenic
1063429809 10:5978125-5978147 CCGCGGCCCCCGGCGCCCGCTGG + Intronic
1066460463 10:35608300-35608322 GCGCGTGCACCCGGGGGCGCCGG - Exonic
1067362416 10:45594709-45594731 CCGCGCGCAGCCGCCGCCGCTGG - Intronic
1070800833 10:79243558-79243580 CCCCGCGCCGCCGCCGCCGCCGG + Intronic
1072654221 10:97319378-97319400 CCGCGGCCCACCGCGCCCGCCGG + Exonic
1073110637 10:101061358-101061380 CCGCCTCTCCCTGCGGCCGCTGG + Intergenic
1073325758 10:102643464-102643486 CGGCCTGGCCCCGCCGCCGCAGG + Intergenic
1073812433 10:107164952-107164974 CTCTGCGCCCCCGCGGCCGCGGG + Intergenic
1074169721 10:110919955-110919977 CCGCCCGCCGCCGCCGCCGCAGG - Intronic
1074592012 10:114822181-114822203 CGGCTTGTCCCCGAGGCCGCCGG - Intronic
1076687573 10:132204968-132204990 CCTGGGGCCCCCGCGGCCTCGGG - Exonic
1076734689 10:132453330-132453352 TCGCGTCCCCGCGTGGCCGCGGG + Intergenic
1076736822 10:132462701-132462723 CCTCCTGGCCCGGCGGCCGCTGG + Intergenic
1076792729 10:132785644-132785666 CCGCGCGCCACAGCGGCCGCGGG + Exonic
1076843192 10:133056683-133056705 CCCCTTGGACCCGCGGCCGCTGG - Intergenic
1077049782 11:561406-561428 ACGCCAGGCCCCGCGGCCGCCGG - Exonic
1077090859 11:777617-777639 CCGCGCGCCCGGGCGGTCGCAGG + Exonic
1078053531 11:7987612-7987634 CAGCCTGACCACGCGGCCGCCGG - Exonic
1082986082 11:59172363-59172385 CCGCGCGCCGCCGCCGCCGCCGG - Intronic
1083227733 11:61295205-61295227 CCGCGTCCCCTCGCGGCCCTCGG - Exonic
1083670942 11:64299674-64299696 CCGTGCGGCCCCGCGGCCCCGGG + Exonic
1084028485 11:66467159-66467181 CCGCGCGTCCCTGCGGTCGCGGG + Intronic
1084086321 11:66856962-66856984 CCGCGTGTCCCCGTGACCTCAGG + Intronic
1087138121 11:94740521-94740543 CCTCGGGCCCCCGGGACCGCGGG + Intronic
1090699313 11:129279631-129279653 AGGCGCGCCGCCGCGGCCGCGGG + Intergenic
1091273228 11:134332294-134332316 CCGAGTTCCCCTGCGGCTGCAGG + Intronic
1093894821 12:24563339-24563361 CCGCGCGTCCCCGCCGCCGCCGG + Intergenic
1096101235 12:48971608-48971630 CCCAGCGCCGCCGCGGCCGCCGG + Exonic
1096241182 12:49961305-49961327 CCGCCCGCCCCCGCCGCCGGCGG + Intergenic
1096255069 12:50057788-50057810 CGGCGTGCCGCGGCGGCCGCGGG + Exonic
1097262353 12:57726812-57726834 CCGCGTGACCGCGCGTCCCCAGG + Intronic
1098991162 12:77065810-77065832 ACGCGGGCCCCGGCGGCCGCGGG + Intergenic
1100260661 12:92929343-92929365 CCCCGCCCCCCGGCGGCCGCGGG - Intergenic
1101482020 12:105107642-105107664 CCAGGGGCCCCCGCGGTCGCAGG + Intronic
1103509773 12:121466753-121466775 CCGGGTGCTCCCGGGGCAGCCGG + Intronic
1104049446 12:125186154-125186176 CCGCGAGCGCCCGCGACCCCCGG + Intergenic
1104688669 12:130807599-130807621 CCTCGTGCCCTCGAGGCCTCAGG + Intronic
1105409764 13:20161530-20161552 CCGCGTCCCCAGGCGGCTGCAGG - Intergenic
1106516946 13:30464653-30464675 GCGCCGGCCCCGGCGGCCGCGGG - Intronic
1106776750 13:33016582-33016604 CCTCCTGCCCCCGAGGCCGCGGG + Exonic
1107935225 13:45340845-45340867 CCGCGTGCGGCCGCCGGCGCGGG - Intronic
1110436461 13:75482095-75482117 CCGAGGGTCCCCGCGGCCGCCGG + Exonic
1113640948 13:111956348-111956370 CCGCGTGCGCTCGGGGACGCGGG + Intergenic
1115850760 14:37588231-37588253 ACGCGGGCCGCCGGGGCCGCAGG + Intergenic
1117251860 14:53946863-53946885 CCTGGTGCCCCCGCCGCCGCCGG + Intergenic
1119261006 14:73237972-73237994 CCGGGAGCCCCAGCGGCTGCCGG + Intronic
1121050452 14:90816362-90816384 CCGCCTCCCGCCGCCGCCGCGGG + Exonic
1121098522 14:91234065-91234087 CTGGGTGCCCCCGAGGCCTCCGG - Exonic
1121758677 14:96424267-96424289 CCCCGTGTCGCCGCTGCCGCCGG - Intronic
1122065825 14:99174030-99174052 CCGCGTGTCCCCGGGGCCCAGGG - Exonic
1122145124 14:99684311-99684333 CCGCGCGCCGCCTCGGCCCCAGG - Exonic
1122294632 14:100698291-100698313 CCGCATGGCCCCACGGCCCCTGG + Intergenic
1122624165 14:103075675-103075697 CCACGTCCCTCGGCGGCCGCGGG - Intergenic
1122779873 14:104139063-104139085 CCGCGAGCCGCCGCCGCTGCTGG + Exonic
1123024986 14:105420167-105420189 CCGCCCGCCCTCGCGGCCCCCGG + Intronic
1124453819 15:29822406-29822428 CCGCGTTCCTTGGCGGCCGCCGG - Exonic
1125674259 15:41494088-41494110 CCGCTTGGCCCCGCGGGCCCGGG - Exonic
1127606315 15:60591841-60591863 CCGAGCGCCTCAGCGGCCGCCGG - Intronic
1128317780 15:66671879-66671901 CAGCCTGCCTCCGCGGCCCCAGG + Intronic
1128455633 15:67829871-67829893 CCGCGAGCGCGCGTGGCCGCCGG - Intronic
1129817237 15:78565694-78565716 CCGCGGTCCCGCGCGGGCGCGGG + Exonic
1130002613 15:80060055-80060077 GCGCGGGCGCCCGCGGCCGGGGG + Intronic
1131277448 15:90994172-90994194 CTGCGGGCACCTGCGGCCGCCGG + Intronic
1131515690 15:93074781-93074803 TAGCGTGCCCCGGTGGCCGCTGG - Intronic
1132589730 16:721415-721437 GCGCGTGCCGCTGCGGCTGCAGG + Exonic
1132601404 16:774686-774708 CCCTCTGCCCCCTCGGCCGCAGG + Intronic
1132843533 16:1989934-1989956 CCGCGCGTCCCCGCCGCGGCCGG + Exonic
1134438864 16:14285742-14285764 CCCCGAGCCCCCGAGCCCGCCGG + Intergenic
1136428369 16:30183797-30183819 CCGCGCGCCCCCGCAGCCCGCGG - Intronic
1139472132 16:67184022-67184044 CGGCGCGCCCCCGAGGCCACTGG + Exonic
1140096969 16:71883835-71883857 CCTCGCCCCCTCGCGGCCGCCGG - Intronic
1142163204 16:88570171-88570193 TCACGTGACCCGGCGGCCGCGGG + Intergenic
1142811799 17:2399022-2399044 CCGTGTGCCGCCGCCGCGGCGGG - Intronic
1143460518 17:7100817-7100839 CGGCCTGCCCCACCGGCCGCGGG - Intergenic
1145243594 17:21253290-21253312 CCGCGCGCCCCGGCCCCCGCCGG - Exonic
1145709923 17:26962757-26962779 CTTCTTGCCCCCGCCGCCGCGGG + Intergenic
1147193222 17:38748901-38748923 CCCCTTGCCCCCTCGGCGGCAGG + Intronic
1147684052 17:42276405-42276427 GCGCGCGCCCCCGCGGGCCCCGG - Exonic
1148786908 17:50150035-50150057 CGGAGCGCCCCAGCGGCCGCAGG - Exonic
1148894316 17:50831203-50831225 CCCCCTGCCCGCGCGGCCTCGGG - Intergenic
1149314048 17:55422016-55422038 CTGCGTGCACCCGCGGTCGCCGG + Intergenic
1150802229 17:68291409-68291431 CGGCGCGCCCCCGAGGCCGGCGG - Intronic
1151490727 17:74431169-74431191 CCGCCTTCCCCCGGGGCTGCTGG - Exonic
1151582453 17:74988027-74988049 CCGCATGGCCCCGCGGGCGGCGG - Exonic
1152135063 17:78498972-78498994 CGACGTGACCCCGAGGCCGCAGG + Intronic
1152534319 17:80941528-80941550 CCCCCTGCCCTCGCGGCCACAGG + Intronic
1152710719 17:81869511-81869533 GCCCGGACCCCCGCGGCCGCAGG + Intronic
1152809544 17:82375071-82375093 GCGCGCGCGCCCCCGGCCGCCGG - Exonic
1153051921 18:908167-908189 GCGCGCGCCCCCTCGGCGGCCGG - Intronic
1160592140 18:79951001-79951023 CCGCGCGCTCCTGCGGCCTCGGG + Exonic
1160809720 19:1008118-1008140 CCGCCTGGCCCCGCGCCCCCAGG + Exonic
1160841041 19:1147175-1147197 CGGCTTGGCCCCTCGGCCGCAGG - Intronic
1160880720 19:1318828-1318850 CAGCGTGCACCTGCGCCCGCCGG + Intergenic
1160967546 19:1753304-1753326 CGGCCTGCCCCAGCGGGCGCGGG + Exonic
1160968604 19:1757571-1757593 CCGCGCGGCCCCGCGGCCGCGGG + Intronic
1161241156 19:3224699-3224721 CCGCCCGCCGCCGCCGCCGCCGG + Exonic
1161350070 19:3786392-3786414 CCGCGCGCCGCCGCCGCCGCCGG + Intronic
1162100494 19:8335741-8335763 CTGCGTGCGCCCCCGGCGGCGGG + Exonic
1162340713 19:10090026-10090048 CCGCGTGCCCCAGCGGAAGGAGG + Exonic
1162410775 19:10503586-10503608 CCTCGTGGTCCGGCGGCCGCAGG + Exonic
1163012200 19:14433318-14433340 CCTCCGGCCCCAGCGGCCGCCGG - Intronic
1163708543 19:18832061-18832083 CCGCGCGCCCCGGCGCCAGCCGG - Exonic
1163829319 19:19540301-19540323 GCGCGTGTGCCCGCGACCGCTGG + Exonic
1164509916 19:28888746-28888768 CCGCATGCCCCTGAGGCTGCAGG - Intergenic
1165463756 19:35959878-35959900 CCGCGGGCCGCGGCGGCCTCGGG - Intergenic
1165994286 19:39833398-39833420 CCGCTTGCCCTCCCCGCCGCGGG - Exonic
1166106683 19:40601235-40601257 ACGCGCCCCCGCGCGGCCGCCGG + Intronic
1167109071 19:47448219-47448241 CAGCGTGCCCTCGCTGCGGCGGG + Exonic
1167643782 19:50695248-50695270 CCCCGCGCCCCCGCGCCCCCCGG - Intronic
1168064006 19:53909323-53909345 CCGAGTGAGGCCGCGGCCGCGGG + Exonic
1168076292 19:53982443-53982465 GCCCGGGCCCCCGGGGCCGCCGG - Exonic
1168247049 19:55117610-55117632 CCGCCCGCCCCGGGGGCCGCCGG + Intergenic
1168305536 19:55433270-55433292 CAGTGTGCCCCCGCCCCCGCCGG + Exonic
926002632 2:9346091-9346113 CCCCCTGCCCCCGCGACCCCAGG + Intronic
926077377 2:9951935-9951957 CCGCCCGCCCGCGCGGCCTCGGG - Intronic
926101857 2:10122967-10122989 ACGCGTCTCCCCGCAGCCGCCGG + Exonic
927357071 2:22186441-22186463 CCGCGGGCCCCGCCGGCCCCGGG + Intergenic
927652346 2:24920211-24920233 GCGCGTGGCCCCGGAGCCGCCGG - Intergenic
927692289 2:25216502-25216524 GCGCGAGCCACCGCGCCCGCCGG - Intergenic
928103287 2:28452038-28452060 CCGCCTGCTCCCACGGCCACAGG - Intergenic
929218038 2:39436856-39436878 CCGCGCGCCGCCGAGGCCGTGGG - Intronic
929958815 2:46480662-46480684 CCTCGTGCTGCCGCTGCCGCTGG - Exonic
931036688 2:58251711-58251733 CAGCCTGACCACGCGGCCGCCGG - Intergenic
931614617 2:64143933-64143955 CTGCGCGCCCCCGCTGCGGCGGG - Intronic
931671795 2:64654059-64654081 CCGCGGCCGGCCGCGGCCGCAGG + Intronic
931711000 2:64989165-64989187 GCCCGCGCCCCCGCGGCCTCGGG + Intronic
932446659 2:71785844-71785866 GCGCTTGCCTGCGCGGCCGCGGG + Intergenic
932567686 2:72919977-72919999 CCGCGGGCCGCCGCGGCCGAGGG + Intronic
932607674 2:73175833-73175855 GCGCCCGCCCCCGCCGCCGCGGG - Intergenic
932621899 2:73269634-73269656 CCGCGTGCCGCGGGGGCGGCGGG - Exonic
932703135 2:74004204-74004226 CCACCTGCCCCCTCAGCCGCTGG + Intronic
934257790 2:91442619-91442641 CTTCCTGCCCCCGCCGCCGCGGG + Intergenic
934566986 2:95346618-95346640 CCCCGCGCCCCGGCGCCCGCGGG + Intronic
934846395 2:97663787-97663809 CCGCGTGCGCCCCCGGGGGCGGG + Intronic
934966844 2:98731061-98731083 CGCCGTGCTCCCGCGGCTGCCGG + Intronic
935645477 2:105330175-105330197 CCGCGTGGTCAGGCGGCCGCGGG - Intergenic
938322087 2:130372431-130372453 CCGCGTGCGCCCCGGGTCGCTGG - Exonic
940009522 2:149038949-149038971 CCGCGGGGCCGCGGGGCCGCGGG + Intronic
940887500 2:159002173-159002195 CCGCCAGCCCCTCCGGCCGCAGG - Intronic
940918899 2:159286582-159286604 CCGCGCGCCCCCGCTCCTGCAGG - Exonic
941008365 2:160270320-160270342 CCGCGGGGCCCCCCGGGCGCAGG - Intronic
941934667 2:170973634-170973656 CCCGGAGACCCCGCGGCCGCTGG - Intergenic
942116755 2:172735815-172735837 CCGCGGGCTCCCGCGGCCTGGGG - Intronic
943725324 2:191246085-191246107 CGGTGTGCCCCGGCGGCGGCGGG + Intronic
946185639 2:217979010-217979032 CCCCCTGCCTCCCCGGCCGCGGG - Intronic
946227027 2:218269658-218269680 CCGCGCGCCCCCGCGGACCCCGG - Intronic
946412638 2:219522737-219522759 CCGCCCGCCCCCGCGGCGGCCGG - Intronic
948751477 2:240135942-240135964 CTGGGTGCCCCCACGGCCCCCGG - Intronic
948801583 2:240435737-240435759 CCCCGCGCCGCCGCCGCCGCCGG + Exonic
948945699 2:241217976-241217998 CTGCGCGCCCCCGCTGCCCCCGG - Intronic
1168757151 20:325699-325721 CGGCGCGCCCCCGCCGCCTCCGG - Exonic
1169220593 20:3820253-3820275 CGGCGCCCCCTCGCGGCCGCCGG + Intergenic
1170999273 20:21396833-21396855 CCGCGCGCCCGCTCGGCCCCAGG + Intronic
1171417440 20:24992640-24992662 GCGCCGGCCCCTGCGGCCGCAGG - Exonic
1172144001 20:32743576-32743598 CCGCGGACACGCGCGGCCGCCGG + Exonic
1174204477 20:48828486-48828508 ACGCGCGCCTCCGCGGCCCCGGG + Intergenic
1176547884 21:8209256-8209278 CCTCGCGCGCCCGCGGGCGCCGG + Intergenic
1176547887 21:8209265-8209287 GCGCGCGCCCCGGCGCCCGCGGG - Intergenic
1179784054 21:43719692-43719714 CCGCCCGCCCCCGCGGCAGTTGG - Intronic
1180163098 21:46006785-46006807 CCTCGTGCCCACACGGCCGGCGG + Intergenic
1183201314 22:36387467-36387489 GCGCGTGCCCCAGCGGCTGGGGG + Intronic
1183537736 22:38412991-38413013 CCGCGGGCCCCTGCGGGCCCCGG - Intergenic
1184216648 22:43071925-43071947 CCTCGTGCCACAGCGGCCACAGG - Intronic
1184276286 22:43411443-43411465 CAGGGTGCCCCGGCGGCCCCAGG + Exonic
1184767074 22:46577504-46577526 CCGCGGGCACCTGCGGCCGCAGG + Intronic
949533403 3:4978538-4978560 CCGGGTGCCCGCCCGCCCGCAGG + Intergenic
949533698 3:4979510-4979532 CCCGGTGTCCCCGCGGCCTCTGG - Exonic
949987522 3:9552697-9552719 CCGCCAGCCGCCGCCGCCGCCGG - Exonic
951558849 3:23946000-23946022 CCACGTGTCCCTGCGGCCCCGGG - Intronic
953912190 3:46898831-46898853 CCGCCTGCCACCGCCGCTGCCGG + Exonic
954392197 3:50273698-50273720 CCGGGAGCCCCCGCCGCAGCGGG + Intronic
955228459 3:57079361-57079383 CCGGGGACCCCCGCGGGCGCCGG + Intergenic
956129111 3:66038120-66038142 CCTCGGGCCCTCGCCGCCGCCGG + Exonic
961674282 3:128555418-128555440 CCGGGTGCCCCGGCCTCCGCCGG - Intergenic
962738864 3:138348665-138348687 CCGCCGGGCCCCGCGGCCGCCGG - Intronic
964227907 3:154428765-154428787 CCGGGTGCGCCCGCTGCCGCTGG - Exonic
968618574 4:1593265-1593287 CCACGTCCCCGCGCGCCCGCAGG + Intergenic
968803196 4:2756304-2756326 CCGGGAGGCCGCGCGGCCGCCGG + Exonic
968850485 4:3074607-3074629 CGGCGTGGCCCCGCCTCCGCCGG + Intergenic
970967872 4:21948843-21948865 CCGCGCGCCCCCGCCGCCAAGGG - Intergenic
971327432 4:25655739-25655761 CCGCCTGCCGCAGCCGCCGCCGG - Intronic
973945341 4:55949152-55949174 CCGGGAGGCCGCGCGGCCGCGGG + Intronic
981782880 4:148445562-148445584 CCGCGCGCCCCCGCGTCTCCTGG + Intergenic
985068446 4:186144978-186145000 TCACGCGCCCCCGCGGCCCCGGG - Exonic
986330774 5:6714488-6714510 CCGCGCGGCCCCGCGCCCGCCGG + Intergenic
987132417 5:14871873-14871895 CAGCCCGCCCCCGGGGCCGCTGG - Intergenic
992487591 5:77210878-77210900 CCGCCCGCGCCCGCGGCCGCCGG - Exonic
995574364 5:113513910-113513932 CAGCGTCTCCCCGCGGCAGCCGG + Exonic
996379035 5:122845508-122845530 CCGCGGGGCCCCGAGGCTGCGGG - Exonic
997304918 5:132830073-132830095 GCGCAGGCCCCGGCGGCCGCAGG + Intronic
999375123 5:151081171-151081193 CCGCGGGCCCCCGGAACCGCAGG - Intronic
999462910 5:151772166-151772188 CCGCGCGCGCCTGCGGCCGTTGG - Intronic
1002692433 5:181059580-181059602 GCGCGTGCCCCCGCGGCGCCTGG + Exonic
1003603808 6:7542007-7542029 GCTGGTGCCCCCGCCGCCGCTGG - Exonic
1004043916 6:12009067-12009089 CGGCGTGACCCGGCGGCCGGCGG + Intronic
1006547597 6:34792444-34792466 CAGCTTCCCCCCGCGCCCGCCGG + Intronic
1006665260 6:35688803-35688825 CGGCGAGCCCCCGCGGCGACAGG - Intronic
1007431516 6:41779904-41779926 CCGCCCCGCCCCGCGGCCGCGGG + Intronic
1007785107 6:44275381-44275403 CCGCCTGCCCCCCGCGCCGCAGG + Exonic
1008816921 6:55579245-55579267 CCCCGTGCACCCGCTGCCCCAGG - Intergenic
1011459688 6:87590104-87590126 CCGCGCGCCCTCGCGGCTGCAGG - Intronic
1011607315 6:89117908-89117930 CCGGGTCTGCCCGCGGCCGCTGG + Exonic
1014233979 6:118935031-118935053 CCGCGCGTCCCCGCGGCCGGTGG - Exonic
1015328508 6:131951077-131951099 CCGGGAGCCCCCGCTGCGGCCGG - Intronic
1016863962 6:148747769-148747791 CCGCGCGCCGCCGCCGCCCCGGG + Intronic
1017446346 6:154510334-154510356 CCTCCTTCCCCCGCCGCCGCCGG + Exonic
1017497637 6:154995561-154995583 CCGCGCGCCGCCCCGCCCGCAGG - Intronic
1019474539 7:1237581-1237603 CCGCGCGCCCCCGCGCGCACTGG + Intergenic
1022106264 7:27199875-27199897 CCCCCTGCCGCCGCAGCCGCCGG + Exonic
1022108438 7:27213370-27213392 CCCGGAGCCCTCGCGGCCGCGGG + Intergenic
1023810326 7:43906520-43906542 CCCTGCGCCCCCGCGGCTGCCGG - Intronic
1024678605 7:51660689-51660711 CCTCCAGCCCCTGCGGCCGCTGG + Intergenic
1026482414 7:70790252-70790274 CAGCGTGCACCCGGGGCCCCTGG + Exonic
1026866628 7:73828080-73828102 CCTCCTGCCCCCCCGGCCCCCGG - Intronic
1029110542 7:98211346-98211368 CCGGGTGTCCCGGCGGGCGCTGG - Intergenic
1029461051 7:100694080-100694102 CCCAGTGGCCCCGCGGCCCCCGG - Intergenic
1034439945 7:151081358-151081380 CCCCGAGCCCCGGCGGTCGCAGG + Exonic
1039542542 8:38383107-38383129 CCGCGAGCAGCCGCGGCCTCCGG - Intergenic
1040495430 8:47961164-47961186 CCCCGAGCCGCCGCGGCAGCCGG + Exonic
1041689900 8:60678705-60678727 CCGCGCGCACCCGAAGCCGCGGG - Intergenic
1041690086 8:60679360-60679382 CCGCGCGCCCCCGCCGCCGCCGG - Intronic
1042591775 8:70403662-70403684 CCGCCCGCCCTCGCGGCCCCGGG + Intronic
1044734943 8:95269318-95269340 CCGCGAGCCCTCGTGGGCGCCGG - Intergenic
1047247899 8:123160594-123160616 CAGCGTCCCCTGGCGGCCGCCGG - Intergenic
1049585301 8:143430161-143430183 CCCCGCGCCGCCGCCGCCGCCGG + Exonic
1049719265 8:144108128-144108150 CCCCGCGCGCCCGCGCCCGCCGG + Exonic
1052494719 9:29212448-29212470 TCGCGCGCCCCCGAGTCCGCAGG + Intergenic
1053066428 9:35072372-35072394 CCGCGGGCCGCCACAGCCGCCGG - Exonic
1055321671 9:75088488-75088510 CCGCCCCGCCCCGCGGCCGCCGG - Intergenic
1056470727 9:86902799-86902821 CCGCGCGCCCCCGCAGAGGCCGG - Intergenic
1056992268 9:91423493-91423515 CCGCGCGCACTCGCCGCCGCTGG + Intronic
1057208150 9:93185251-93185273 CCCGGAGCCCCCGCGGACGCCGG + Exonic
1057546133 9:96021489-96021511 CCCCGTGTCCCCCAGGCCGCGGG - Intergenic
1057772952 9:97983796-97983818 CCGCGGGCCCCTGGGGCGGCCGG + Intronic
1059634011 9:116154623-116154645 CCGCGAGCCTCTGGGGCCGCAGG - Intronic
1060700940 9:125748017-125748039 GCGCCGGCTCCCGCGGCCGCGGG + Intronic
1061575235 9:131502149-131502171 GCACGTGCCCCCACGCCCGCGGG - Intergenic
1062248572 9:135583070-135583092 CCGCGTGCCCCCAGGGCTGGTGG - Intergenic
1062272235 9:135714808-135714830 CCGCGCGCCCCCGCAGCCGCCGG + Intronic
1062470499 9:136701560-136701582 CCGGGGGCCCCAGCGCCCGCAGG + Intergenic
1062630773 9:137462142-137462164 CCGCCCGCCTCCGCCGCCGCGGG + Intronic
1185778813 X:2828862-2828884 CCGCCAGCCCCCGCGGGCGCGGG - Exonic
1186660643 X:11664995-11665017 CCAAGTGCCCCGGCGGCGGCAGG + Exonic
1187915549 X:24149802-24149824 CCGGGTGCCGCCGCGGCCGCGGG + Intronic
1192274748 X:69616927-69616949 TCGCGCGCGCCCGCGGCCCCTGG + Intronic
1198767163 X:140091576-140091598 CCGCGCGCCCGCCCGCCCGCAGG + Intergenic
1200111854 X:153744525-153744547 CCGTGTGCCCCGGTGGCGGCTGG - Exonic
1200128909 X:153830643-153830665 CCGCGCGCCTCCCCGCCCGCGGG + Intergenic
1200249885 X:154547181-154547203 CCGCGAGCGCGCGAGGCCGCCGG - Exonic
1200418259 Y:2935454-2935476 CCGCGTGCCCCCGCGGCCGCGGG + Intronic