ID: 1200425093

View in Genome Browser
Species Human (GRCh38)
Location Y:3011663-3011685
Sequence ACATATAAACTCCAGCTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200425093_1200425096 2 Left 1200425093 Y:3011663-3011685 CCTCCTAGCTGGAGTTTATATGT No data
Right 1200425096 Y:3011688-3011710 AAGAAACAAAATAACTTGATGGG No data
1200425093_1200425097 21 Left 1200425093 Y:3011663-3011685 CCTCCTAGCTGGAGTTTATATGT No data
Right 1200425097 Y:3011707-3011729 TGGGTATACTTTCCACAGTCTGG No data
1200425093_1200425095 1 Left 1200425093 Y:3011663-3011685 CCTCCTAGCTGGAGTTTATATGT No data
Right 1200425095 Y:3011687-3011709 GAAGAAACAAAATAACTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200425093 Original CRISPR ACATATAAACTCCAGCTAGG AGG (reversed) Intergenic
No off target data available for this crispr