ID: 1200425896

View in Genome Browser
Species Human (GRCh38)
Location Y:3019979-3020001
Sequence TTAGGCAGAGAGGAAAAAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200425896_1200425900 15 Left 1200425896 Y:3019979-3020001 CCCGTTTTTTCCTCTCTGCCTAA No data
Right 1200425900 Y:3020017-3020039 ACTCTTACCACAATTTTAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200425896 Original CRISPR TTAGGCAGAGAGGAAAAAAC GGG (reversed) Intergenic
No off target data available for this crispr