ID: 1200436574

View in Genome Browser
Species Human (GRCh38)
Location Y:3158513-3158535
Sequence CTGTGTCCCCAAAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200436574_1200436578 23 Left 1200436574 Y:3158513-3158535 CCTTCTTCCCTTTGGGGACACAG No data
Right 1200436578 Y:3158559-3158581 AAATAACAGCTCCTTAATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200436574 Original CRISPR CTGTGTCCCCAAAGGGAAGA AGG (reversed) Intergenic
No off target data available for this crispr