ID: 1200440708

View in Genome Browser
Species Human (GRCh38)
Location Y:3208818-3208840
Sequence TAATTGGTATAGATAATCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200440708_1200440712 17 Left 1200440708 Y:3208818-3208840 CCTGAGATTATCTATACCAATTA No data
Right 1200440712 Y:3208858-3208880 GAATTAAGCACAGAATGATTTGG No data
1200440708_1200440714 19 Left 1200440708 Y:3208818-3208840 CCTGAGATTATCTATACCAATTA No data
Right 1200440714 Y:3208860-3208882 ATTAAGCACAGAATGATTTGGGG No data
1200440708_1200440710 -6 Left 1200440708 Y:3208818-3208840 CCTGAGATTATCTATACCAATTA No data
Right 1200440710 Y:3208835-3208857 CAATTATAGATTATGAAACTAGG No data
1200440708_1200440713 18 Left 1200440708 Y:3208818-3208840 CCTGAGATTATCTATACCAATTA No data
Right 1200440713 Y:3208859-3208881 AATTAAGCACAGAATGATTTGGG No data
1200440708_1200440711 -5 Left 1200440708 Y:3208818-3208840 CCTGAGATTATCTATACCAATTA No data
Right 1200440711 Y:3208836-3208858 AATTATAGATTATGAAACTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200440708 Original CRISPR TAATTGGTATAGATAATCTC AGG (reversed) Intergenic
No off target data available for this crispr