ID: 1200440708 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | Y:3208818-3208840 |
| Sequence | TAATTGGTATAGATAATCTC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 5 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1200440708_1200440712 | 17 | Left | 1200440708 | Y:3208818-3208840 | CCTGAGATTATCTATACCAATTA | No data | ||
| Right | 1200440712 | Y:3208858-3208880 | GAATTAAGCACAGAATGATTTGG | No data | ||||
| 1200440708_1200440714 | 19 | Left | 1200440708 | Y:3208818-3208840 | CCTGAGATTATCTATACCAATTA | No data | ||
| Right | 1200440714 | Y:3208860-3208882 | ATTAAGCACAGAATGATTTGGGG | No data | ||||
| 1200440708_1200440710 | -6 | Left | 1200440708 | Y:3208818-3208840 | CCTGAGATTATCTATACCAATTA | No data | ||
| Right | 1200440710 | Y:3208835-3208857 | CAATTATAGATTATGAAACTAGG | No data | ||||
| 1200440708_1200440713 | 18 | Left | 1200440708 | Y:3208818-3208840 | CCTGAGATTATCTATACCAATTA | No data | ||
| Right | 1200440713 | Y:3208859-3208881 | AATTAAGCACAGAATGATTTGGG | No data | ||||
| 1200440708_1200440711 | -5 | Left | 1200440708 | Y:3208818-3208840 | CCTGAGATTATCTATACCAATTA | No data | ||
| Right | 1200440711 | Y:3208836-3208858 | AATTATAGATTATGAAACTAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1200440708 | Original CRISPR | TAATTGGTATAGATAATCTC AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||