ID: 1200440713 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | Y:3208859-3208881 |
| Sequence | AATTAAGCACAGAATGATTT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1200440707_1200440713 | 24 | Left | 1200440707 | Y:3208812-3208834 | CCAGTTCCTGAGATTATCTATAC | No data | ||
| Right | 1200440713 | Y:3208859-3208881 | AATTAAGCACAGAATGATTTGGG | No data | ||||
| 1200440709_1200440713 | 2 | Left | 1200440709 | Y:3208834-3208856 | CCAATTATAGATTATGAAACTAG | No data | ||
| Right | 1200440713 | Y:3208859-3208881 | AATTAAGCACAGAATGATTTGGG | No data | ||||
| 1200440708_1200440713 | 18 | Left | 1200440708 | Y:3208818-3208840 | CCTGAGATTATCTATACCAATTA | No data | ||
| Right | 1200440713 | Y:3208859-3208881 | AATTAAGCACAGAATGATTTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1200440713 | Original CRISPR | AATTAAGCACAGAATGATTT GGG | Intergenic | ||
| No off target data available for this crispr | |||||