ID: 1200440714

View in Genome Browser
Species Human (GRCh38)
Location Y:3208860-3208882
Sequence ATTAAGCACAGAATGATTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200440708_1200440714 19 Left 1200440708 Y:3208818-3208840 CCTGAGATTATCTATACCAATTA No data
Right 1200440714 Y:3208860-3208882 ATTAAGCACAGAATGATTTGGGG No data
1200440707_1200440714 25 Left 1200440707 Y:3208812-3208834 CCAGTTCCTGAGATTATCTATAC No data
Right 1200440714 Y:3208860-3208882 ATTAAGCACAGAATGATTTGGGG No data
1200440709_1200440714 3 Left 1200440709 Y:3208834-3208856 CCAATTATAGATTATGAAACTAG No data
Right 1200440714 Y:3208860-3208882 ATTAAGCACAGAATGATTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200440714 Original CRISPR ATTAAGCACAGAATGATTTG GGG Intergenic
No off target data available for this crispr