ID: 1200440715

View in Genome Browser
Species Human (GRCh38)
Location Y:3208880-3208902
Sequence GGGCACCCTCTAGATCCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200440709_1200440715 23 Left 1200440709 Y:3208834-3208856 CCAATTATAGATTATGAAACTAG No data
Right 1200440715 Y:3208880-3208902 GGGCACCCTCTAGATCCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200440715 Original CRISPR GGGCACCCTCTAGATCCTGA AGG Intergenic
No off target data available for this crispr