ID: 1200443465

View in Genome Browser
Species Human (GRCh38)
Location Y:3236811-3236833
Sequence GCTTCCGGACTGACCAGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200443463_1200443465 -5 Left 1200443463 Y:3236793-3236815 CCATGTATAGACTGGTCAGCTTC No data
Right 1200443465 Y:3236811-3236833 GCTTCCGGACTGACCAGAGCAGG No data
1200443461_1200443465 8 Left 1200443461 Y:3236780-3236802 CCTCAAGCTTCAGCCATGTATAG No data
Right 1200443465 Y:3236811-3236833 GCTTCCGGACTGACCAGAGCAGG No data
1200443460_1200443465 11 Left 1200443460 Y:3236777-3236799 CCTCCTCAAGCTTCAGCCATGTA No data
Right 1200443465 Y:3236811-3236833 GCTTCCGGACTGACCAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200443465 Original CRISPR GCTTCCGGACTGACCAGAGC AGG Intergenic
No off target data available for this crispr