ID: 1200457858

View in Genome Browser
Species Human (GRCh38)
Location Y:3414729-3414751
Sequence TGAGCTCTGGTAACAAGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200457858_1200457863 15 Left 1200457858 Y:3414729-3414751 CCTCCTCTTGTTACCAGAGCTCA No data
Right 1200457863 Y:3414767-3414789 TCAGGCTTTCCTGACATCATAGG No data
1200457858_1200457861 -3 Left 1200457858 Y:3414729-3414751 CCTCCTCTTGTTACCAGAGCTCA No data
Right 1200457861 Y:3414749-3414771 TCAAAATAATTCCTCTTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200457858 Original CRISPR TGAGCTCTGGTAACAAGAGG AGG (reversed) Intergenic
No off target data available for this crispr