ID: 1200457861

View in Genome Browser
Species Human (GRCh38)
Location Y:3414749-3414771
Sequence TCAAAATAATTCCTCTTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200457859_1200457861 -6 Left 1200457859 Y:3414732-3414754 CCTCTTGTTACCAGAGCTCAAAA No data
Right 1200457861 Y:3414749-3414771 TCAAAATAATTCCTCTTGTCAGG No data
1200457858_1200457861 -3 Left 1200457858 Y:3414729-3414751 CCTCCTCTTGTTACCAGAGCTCA No data
Right 1200457861 Y:3414749-3414771 TCAAAATAATTCCTCTTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200457861 Original CRISPR TCAAAATAATTCCTCTTGTC AGG Intergenic
No off target data available for this crispr