ID: 1200468059

View in Genome Browser
Species Human (GRCh38)
Location Y:3545941-3545963
Sequence TAGGGTGGTTAAGAGAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200468059_1200468068 28 Left 1200468059 Y:3545941-3545963 CCAGCACTCTCTTAACCACCCTA No data
Right 1200468068 Y:3545992-3546014 TGCCCCCAGTCCACCAGCTCTGG No data
1200468059_1200468069 29 Left 1200468059 Y:3545941-3545963 CCAGCACTCTCTTAACCACCCTA No data
Right 1200468069 Y:3545993-3546015 GCCCCCAGTCCACCAGCTCTGGG No data
1200468059_1200468062 -6 Left 1200468059 Y:3545941-3545963 CCAGCACTCTCTTAACCACCCTA No data
Right 1200468062 Y:3545958-3545980 ACCCTACCTGGCATCTCAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200468059 Original CRISPR TAGGGTGGTTAAGAGAGTGC TGG (reversed) Intergenic
No off target data available for this crispr