ID: 1200468061

View in Genome Browser
Species Human (GRCh38)
Location Y:3545956-3545978
Sequence TATTGAGATGCCAGGTAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200468061_1200468076 30 Left 1200468061 Y:3545956-3545978 CCACCCTACCTGGCATCTCAATA No data
Right 1200468076 Y:3546009-3546031 CTCTGGGCCTAGTTTAGTACAGG No data
1200468061_1200468069 14 Left 1200468061 Y:3545956-3545978 CCACCCTACCTGGCATCTCAATA No data
Right 1200468069 Y:3545993-3546015 GCCCCCAGTCCACCAGCTCTGGG No data
1200468061_1200468068 13 Left 1200468061 Y:3545956-3545978 CCACCCTACCTGGCATCTCAATA No data
Right 1200468068 Y:3545992-3546014 TGCCCCCAGTCCACCAGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200468061 Original CRISPR TATTGAGATGCCAGGTAGGG TGG (reversed) Intergenic
No off target data available for this crispr