ID: 1200468062

View in Genome Browser
Species Human (GRCh38)
Location Y:3545958-3545980
Sequence ACCCTACCTGGCATCTCAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200468058_1200468062 18 Left 1200468058 Y:3545917-3545939 CCTGGGGTCAGAAGAGGGGCGAT No data
Right 1200468062 Y:3545958-3545980 ACCCTACCTGGCATCTCAATAGG No data
1200468059_1200468062 -6 Left 1200468059 Y:3545941-3545963 CCAGCACTCTCTTAACCACCCTA No data
Right 1200468062 Y:3545958-3545980 ACCCTACCTGGCATCTCAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200468062 Original CRISPR ACCCTACCTGGCATCTCAAT AGG Intergenic
No off target data available for this crispr