ID: 1200468063

View in Genome Browser
Species Human (GRCh38)
Location Y:3545959-3545981
Sequence ACCTATTGAGATGCCAGGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200468063_1200468076 27 Left 1200468063 Y:3545959-3545981 CCCTACCTGGCATCTCAATAGGT No data
Right 1200468076 Y:3546009-3546031 CTCTGGGCCTAGTTTAGTACAGG No data
1200468063_1200468077 28 Left 1200468063 Y:3545959-3545981 CCCTACCTGGCATCTCAATAGGT No data
Right 1200468077 Y:3546010-3546032 TCTGGGCCTAGTTTAGTACAGGG No data
1200468063_1200468068 10 Left 1200468063 Y:3545959-3545981 CCCTACCTGGCATCTCAATAGGT No data
Right 1200468068 Y:3545992-3546014 TGCCCCCAGTCCACCAGCTCTGG No data
1200468063_1200468069 11 Left 1200468063 Y:3545959-3545981 CCCTACCTGGCATCTCAATAGGT No data
Right 1200468069 Y:3545993-3546015 GCCCCCAGTCCACCAGCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200468063 Original CRISPR ACCTATTGAGATGCCAGGTA GGG (reversed) Intergenic
No off target data available for this crispr