ID: 1200468065

View in Genome Browser
Species Human (GRCh38)
Location Y:3545964-3545986
Sequence ACATGACCTATTGAGATGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200468065_1200468077 23 Left 1200468065 Y:3545964-3545986 CCTGGCATCTCAATAGGTCATGT No data
Right 1200468077 Y:3546010-3546032 TCTGGGCCTAGTTTAGTACAGGG No data
1200468065_1200468068 5 Left 1200468065 Y:3545964-3545986 CCTGGCATCTCAATAGGTCATGT No data
Right 1200468068 Y:3545992-3546014 TGCCCCCAGTCCACCAGCTCTGG No data
1200468065_1200468076 22 Left 1200468065 Y:3545964-3545986 CCTGGCATCTCAATAGGTCATGT No data
Right 1200468076 Y:3546009-3546031 CTCTGGGCCTAGTTTAGTACAGG No data
1200468065_1200468069 6 Left 1200468065 Y:3545964-3545986 CCTGGCATCTCAATAGGTCATGT No data
Right 1200468069 Y:3545993-3546015 GCCCCCAGTCCACCAGCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200468065 Original CRISPR ACATGACCTATTGAGATGCC AGG (reversed) Intergenic
No off target data available for this crispr