ID: 1200468069

View in Genome Browser
Species Human (GRCh38)
Location Y:3545993-3546015
Sequence GCCCCCAGTCCACCAGCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200468059_1200468069 29 Left 1200468059 Y:3545941-3545963 CCAGCACTCTCTTAACCACCCTA No data
Right 1200468069 Y:3545993-3546015 GCCCCCAGTCCACCAGCTCTGGG No data
1200468061_1200468069 14 Left 1200468061 Y:3545956-3545978 CCACCCTACCTGGCATCTCAATA No data
Right 1200468069 Y:3545993-3546015 GCCCCCAGTCCACCAGCTCTGGG No data
1200468065_1200468069 6 Left 1200468065 Y:3545964-3545986 CCTGGCATCTCAATAGGTCATGT No data
Right 1200468069 Y:3545993-3546015 GCCCCCAGTCCACCAGCTCTGGG No data
1200468063_1200468069 11 Left 1200468063 Y:3545959-3545981 CCCTACCTGGCATCTCAATAGGT No data
Right 1200468069 Y:3545993-3546015 GCCCCCAGTCCACCAGCTCTGGG No data
1200468064_1200468069 10 Left 1200468064 Y:3545960-3545982 CCTACCTGGCATCTCAATAGGTC No data
Right 1200468069 Y:3545993-3546015 GCCCCCAGTCCACCAGCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200468069 Original CRISPR GCCCCCAGTCCACCAGCTCT GGG Intergenic
No off target data available for this crispr