ID: 1200472974

View in Genome Browser
Species Human (GRCh38)
Location Y:3608968-3608990
Sequence CTTTTAATGTGTAGAATGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200472974_1200472979 22 Left 1200472974 Y:3608968-3608990 CCAACCATTCTACACATTAAAAG No data
Right 1200472979 Y:3609013-3609035 CTTGTTGTTCAGGGTGTGAAAGG No data
1200472974_1200472976 12 Left 1200472974 Y:3608968-3608990 CCAACCATTCTACACATTAAAAG No data
Right 1200472976 Y:3609003-3609025 AAACATGCCACTTGTTGTTCAGG No data
1200472974_1200472977 13 Left 1200472974 Y:3608968-3608990 CCAACCATTCTACACATTAAAAG No data
Right 1200472977 Y:3609004-3609026 AACATGCCACTTGTTGTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200472974 Original CRISPR CTTTTAATGTGTAGAATGGT TGG (reversed) Intergenic
No off target data available for this crispr