ID: 1200472975

View in Genome Browser
Species Human (GRCh38)
Location Y:3608972-3608994
Sequence TTAACTTTTAATGTGTAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200472975_1200472980 30 Left 1200472975 Y:3608972-3608994 CCATTCTACACATTAAAAGTTAA No data
Right 1200472980 Y:3609025-3609047 GGTGTGAAAGGAAAATATCTTGG No data
1200472975_1200472979 18 Left 1200472975 Y:3608972-3608994 CCATTCTACACATTAAAAGTTAA No data
Right 1200472979 Y:3609013-3609035 CTTGTTGTTCAGGGTGTGAAAGG No data
1200472975_1200472977 9 Left 1200472975 Y:3608972-3608994 CCATTCTACACATTAAAAGTTAA No data
Right 1200472977 Y:3609004-3609026 AACATGCCACTTGTTGTTCAGGG No data
1200472975_1200472976 8 Left 1200472975 Y:3608972-3608994 CCATTCTACACATTAAAAGTTAA No data
Right 1200472976 Y:3609003-3609025 AAACATGCCACTTGTTGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200472975 Original CRISPR TTAACTTTTAATGTGTAGAA TGG (reversed) Intergenic
No off target data available for this crispr