ID: 1200472977

View in Genome Browser
Species Human (GRCh38)
Location Y:3609004-3609026
Sequence AACATGCCACTTGTTGTTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200472975_1200472977 9 Left 1200472975 Y:3608972-3608994 CCATTCTACACATTAAAAGTTAA No data
Right 1200472977 Y:3609004-3609026 AACATGCCACTTGTTGTTCAGGG No data
1200472974_1200472977 13 Left 1200472974 Y:3608968-3608990 CCAACCATTCTACACATTAAAAG No data
Right 1200472977 Y:3609004-3609026 AACATGCCACTTGTTGTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200472977 Original CRISPR AACATGCCACTTGTTGTTCA GGG Intergenic
No off target data available for this crispr