ID: 1200476054

View in Genome Browser
Species Human (GRCh38)
Location Y:3643150-3643172
Sequence CTGCTGGCATATTGGGCGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200476054_1200476058 2 Left 1200476054 Y:3643150-3643172 CCAAGCGCCCAATATGCCAGCAG No data
Right 1200476058 Y:3643175-3643197 TAGAACACTGAGAATCTAATAGG No data
1200476054_1200476059 17 Left 1200476054 Y:3643150-3643172 CCAAGCGCCCAATATGCCAGCAG No data
Right 1200476059 Y:3643190-3643212 CTAATAGGACACCATTTACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200476054 Original CRISPR CTGCTGGCATATTGGGCGCT TGG (reversed) Intergenic
No off target data available for this crispr