ID: 1200476491

View in Genome Browser
Species Human (GRCh38)
Location Y:3646434-3646456
Sequence TTGGACTAGCAAGAAATCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200476487_1200476491 23 Left 1200476487 Y:3646388-3646410 CCAAAGAAGTTACATGTTTCATC No data
Right 1200476491 Y:3646434-3646456 TTGGACTAGCAAGAAATCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200476491 Original CRISPR TTGGACTAGCAAGAAATCAT TGG Intergenic
No off target data available for this crispr