ID: 1200478445

View in Genome Browser
Species Human (GRCh38)
Location Y:3671023-3671045
Sequence TTTATCCAGTCTATAATCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200478443_1200478445 3 Left 1200478443 Y:3670997-3671019 CCATGCTGTATATGTACCACACT No data
Right 1200478445 Y:3671023-3671045 TTTATCCAGTCTATAATCAATGG No data
1200478442_1200478445 26 Left 1200478442 Y:3670974-3670996 CCTTTTTATGGCTGCATAGTATT 0: 2638
1: 2717
2: 3602
3: 4585
4: 5275
Right 1200478445 Y:3671023-3671045 TTTATCCAGTCTATAATCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200478445 Original CRISPR TTTATCCAGTCTATAATCAA TGG Intergenic
No off target data available for this crispr