ID: 1200488337

View in Genome Browser
Species Human (GRCh38)
Location Y:3792215-3792237
Sequence GAGAATAAGGCGAATGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200488332_1200488337 -10 Left 1200488332 Y:3792202-3792224 CCAGAGAAGAAGAGAGAATAAGG No data
Right 1200488337 Y:3792215-3792237 GAGAATAAGGCGAATGGGGCTGG No data
1200488330_1200488337 -3 Left 1200488330 Y:3792195-3792217 CCCAGGGCCAGAGAAGAAGAGAG No data
Right 1200488337 Y:3792215-3792237 GAGAATAAGGCGAATGGGGCTGG No data
1200488327_1200488337 15 Left 1200488327 Y:3792177-3792199 CCAGGGTCTGGAGGTTAGCCCAG No data
Right 1200488337 Y:3792215-3792237 GAGAATAAGGCGAATGGGGCTGG No data
1200488331_1200488337 -4 Left 1200488331 Y:3792196-3792218 CCAGGGCCAGAGAAGAAGAGAGA No data
Right 1200488337 Y:3792215-3792237 GAGAATAAGGCGAATGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200488337 Original CRISPR GAGAATAAGGCGAATGGGGC TGG Intergenic
No off target data available for this crispr