ID: 1200492938

View in Genome Browser
Species Human (GRCh38)
Location Y:3850711-3850733
Sequence GCTTAAGCATGTGCACTAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200492938_1200492942 8 Left 1200492938 Y:3850711-3850733 CCTCTTAGTGCACATGCTTAAGC No data
Right 1200492942 Y:3850742-3850764 CCAACTCCTAAGATCTTATTGGG No data
1200492938_1200492940 7 Left 1200492938 Y:3850711-3850733 CCTCTTAGTGCACATGCTTAAGC No data
Right 1200492940 Y:3850741-3850763 TCCAACTCCTAAGATCTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200492938 Original CRISPR GCTTAAGCATGTGCACTAAG AGG (reversed) Intergenic
No off target data available for this crispr