ID: 1200496281

View in Genome Browser
Species Human (GRCh38)
Location Y:3887219-3887241
Sequence AGGTTGTCCCATCACAAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200496281_1200496284 4 Left 1200496281 Y:3887219-3887241 CCATGCTTGTGATGGGACAACCT No data
Right 1200496284 Y:3887246-3887268 TGAAGGTCTCTGAAATTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200496281 Original CRISPR AGGTTGTCCCATCACAAGCA TGG (reversed) Intergenic
No off target data available for this crispr