ID: 1200499133

View in Genome Browser
Species Human (GRCh38)
Location Y:3922441-3922463
Sequence GGGGTGGTCAATGCAAATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200499128_1200499133 2 Left 1200499128 Y:3922416-3922438 CCACTTACGATTACATGCAAATT No data
Right 1200499133 Y:3922441-3922463 GGGGTGGTCAATGCAAATTGAGG No data
1200499127_1200499133 3 Left 1200499127 Y:3922415-3922437 CCCACTTACGATTACATGCAAAT No data
Right 1200499133 Y:3922441-3922463 GGGGTGGTCAATGCAAATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200499133 Original CRISPR GGGGTGGTCAATGCAAATTG AGG Intergenic
No off target data available for this crispr