ID: 1200501436

View in Genome Browser
Species Human (GRCh38)
Location Y:3955276-3955298
Sequence GGCCTAAATAGAACAAAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200501436_1200501442 -9 Left 1200501436 Y:3955276-3955298 CCCCCTTTTGTTCTATTTAGGCC No data
Right 1200501442 Y:3955290-3955312 ATTTAGGCCCTCAGGAGATTGGG No data
1200501436_1200501445 10 Left 1200501436 Y:3955276-3955298 CCCCCTTTTGTTCTATTTAGGCC No data
Right 1200501445 Y:3955309-3955331 TGGGAGATGCCCACTCACAATGG No data
1200501436_1200501441 -10 Left 1200501436 Y:3955276-3955298 CCCCCTTTTGTTCTATTTAGGCC No data
Right 1200501441 Y:3955289-3955311 TATTTAGGCCCTCAGGAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200501436 Original CRISPR GGCCTAAATAGAACAAAAGG GGG (reversed) Intergenic
No off target data available for this crispr