ID: 1200501442

View in Genome Browser
Species Human (GRCh38)
Location Y:3955290-3955312
Sequence ATTTAGGCCCTCAGGAGATT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200501437_1200501442 -10 Left 1200501437 Y:3955277-3955299 CCCCTTTTGTTCTATTTAGGCCC No data
Right 1200501442 Y:3955290-3955312 ATTTAGGCCCTCAGGAGATTGGG No data
1200501434_1200501442 -6 Left 1200501434 Y:3955273-3955295 CCTCCCCCTTTTGTTCTATTTAG No data
Right 1200501442 Y:3955290-3955312 ATTTAGGCCCTCAGGAGATTGGG No data
1200501436_1200501442 -9 Left 1200501436 Y:3955276-3955298 CCCCCTTTTGTTCTATTTAGGCC No data
Right 1200501442 Y:3955290-3955312 ATTTAGGCCCTCAGGAGATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200501442 Original CRISPR ATTTAGGCCCTCAGGAGATT GGG Intergenic
No off target data available for this crispr