ID: 1200501445

View in Genome Browser
Species Human (GRCh38)
Location Y:3955309-3955331
Sequence TGGGAGATGCCCACTCACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200501438_1200501445 8 Left 1200501438 Y:3955278-3955300 CCCTTTTGTTCTATTTAGGCCCT No data
Right 1200501445 Y:3955309-3955331 TGGGAGATGCCCACTCACAATGG No data
1200501436_1200501445 10 Left 1200501436 Y:3955276-3955298 CCCCCTTTTGTTCTATTTAGGCC No data
Right 1200501445 Y:3955309-3955331 TGGGAGATGCCCACTCACAATGG No data
1200501434_1200501445 13 Left 1200501434 Y:3955273-3955295 CCTCCCCCTTTTGTTCTATTTAG No data
Right 1200501445 Y:3955309-3955331 TGGGAGATGCCCACTCACAATGG No data
1200501439_1200501445 7 Left 1200501439 Y:3955279-3955301 CCTTTTGTTCTATTTAGGCCCTC No data
Right 1200501445 Y:3955309-3955331 TGGGAGATGCCCACTCACAATGG No data
1200501437_1200501445 9 Left 1200501437 Y:3955277-3955299 CCCCTTTTGTTCTATTTAGGCCC No data
Right 1200501445 Y:3955309-3955331 TGGGAGATGCCCACTCACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200501445 Original CRISPR TGGGAGATGCCCACTCACAA TGG Intergenic
No off target data available for this crispr