ID: 1200501634

View in Genome Browser
Species Human (GRCh38)
Location Y:3957348-3957370
Sequence TCAGTATGCAATTGCACCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200501631_1200501634 3 Left 1200501631 Y:3957322-3957344 CCAAACTACTGGTCACAGCCCAT No data
Right 1200501634 Y:3957348-3957370 TCAGTATGCAATTGCACCTCTGG No data
1200501628_1200501634 16 Left 1200501628 Y:3957309-3957331 CCTGACCAACTAGCCAAACTACT No data
Right 1200501634 Y:3957348-3957370 TCAGTATGCAATTGCACCTCTGG No data
1200501626_1200501634 23 Left 1200501626 Y:3957302-3957324 CCAAGTCCCTGACCAACTAGCCA No data
Right 1200501634 Y:3957348-3957370 TCAGTATGCAATTGCACCTCTGG No data
1200501627_1200501634 17 Left 1200501627 Y:3957308-3957330 CCCTGACCAACTAGCCAAACTAC No data
Right 1200501634 Y:3957348-3957370 TCAGTATGCAATTGCACCTCTGG No data
1200501630_1200501634 11 Left 1200501630 Y:3957314-3957336 CCAACTAGCCAAACTACTGGTCA No data
Right 1200501634 Y:3957348-3957370 TCAGTATGCAATTGCACCTCTGG No data
1200501625_1200501634 27 Left 1200501625 Y:3957298-3957320 CCTTCCAAGTCCCTGACCAACTA No data
Right 1200501634 Y:3957348-3957370 TCAGTATGCAATTGCACCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200501634 Original CRISPR TCAGTATGCAATTGCACCTC TGG Intergenic
No off target data available for this crispr