ID: 1200501688

View in Genome Browser
Species Human (GRCh38)
Location Y:3957896-3957918
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200501686_1200501688 4 Left 1200501686 Y:3957869-3957891 CCAAGAACTGTTTCTCAAAAGGA No data
Right 1200501688 Y:3957896-3957918 AGTCATCTTCAGAGGATGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200501688 Original CRISPR AGTCATCTTCAGAGGATGAC AGG Intergenic
No off target data available for this crispr