ID: 1200513591

View in Genome Browser
Species Human (GRCh38)
Location Y:4112042-4112064
Sequence GCATTGAAACTGCTGGTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200513591_1200513595 -3 Left 1200513591 Y:4112042-4112064 CCAAGAACCAGCAGTTTCAATGC No data
Right 1200513595 Y:4112062-4112084 TGCCCAAGGGCAGCAGAAGATGG No data
1200513591_1200513598 13 Left 1200513591 Y:4112042-4112064 CCAAGAACCAGCAGTTTCAATGC No data
Right 1200513598 Y:4112078-4112100 AAGATGGCTATTCCAGCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200513591 Original CRISPR GCATTGAAACTGCTGGTTCT TGG (reversed) Intergenic
No off target data available for this crispr