ID: 1200513591 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | Y:4112042-4112064 |
| Sequence | GCATTGAAACTGCTGGTTCT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1200513591_1200513595 | -3 | Left | 1200513591 | Y:4112042-4112064 | CCAAGAACCAGCAGTTTCAATGC | No data | ||
| Right | 1200513595 | Y:4112062-4112084 | TGCCCAAGGGCAGCAGAAGATGG | No data | ||||
| 1200513591_1200513598 | 13 | Left | 1200513591 | Y:4112042-4112064 | CCAAGAACCAGCAGTTTCAATGC | No data | ||
| Right | 1200513598 | Y:4112078-4112100 | AAGATGGCTATTCCAGCTCAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1200513591 | Original CRISPR | GCATTGAAACTGCTGGTTCT TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||