ID: 1200513595

View in Genome Browser
Species Human (GRCh38)
Location Y:4112062-4112084
Sequence TGCCCAAGGGCAGCAGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200513589_1200513595 13 Left 1200513589 Y:4112026-4112048 CCCACAGTCTGAAGGTCCAAGAA No data
Right 1200513595 Y:4112062-4112084 TGCCCAAGGGCAGCAGAAGATGG No data
1200513590_1200513595 12 Left 1200513590 Y:4112027-4112049 CCACAGTCTGAAGGTCCAAGAAC No data
Right 1200513595 Y:4112062-4112084 TGCCCAAGGGCAGCAGAAGATGG No data
1200513593_1200513595 -10 Left 1200513593 Y:4112049-4112071 CCAGCAGTTTCAATGCCCAAGGG No data
Right 1200513595 Y:4112062-4112084 TGCCCAAGGGCAGCAGAAGATGG No data
1200513591_1200513595 -3 Left 1200513591 Y:4112042-4112064 CCAAGAACCAGCAGTTTCAATGC No data
Right 1200513595 Y:4112062-4112084 TGCCCAAGGGCAGCAGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200513595 Original CRISPR TGCCCAAGGGCAGCAGAAGA TGG Intergenic
No off target data available for this crispr