ID: 1200513598

View in Genome Browser
Species Human (GRCh38)
Location Y:4112078-4112100
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200513591_1200513598 13 Left 1200513591 Y:4112042-4112064 CCAAGAACCAGCAGTTTCAATGC No data
Right 1200513598 Y:4112078-4112100 AAGATGGCTATTCCAGCTCAAGG No data
1200513593_1200513598 6 Left 1200513593 Y:4112049-4112071 CCAGCAGTTTCAATGCCCAAGGG No data
Right 1200513598 Y:4112078-4112100 AAGATGGCTATTCCAGCTCAAGG No data
1200513590_1200513598 28 Left 1200513590 Y:4112027-4112049 CCACAGTCTGAAGGTCCAAGAAC No data
Right 1200513598 Y:4112078-4112100 AAGATGGCTATTCCAGCTCAAGG No data
1200513597_1200513598 -10 Left 1200513597 Y:4112065-4112087 CCAAGGGCAGCAGAAGATGGCTA No data
Right 1200513598 Y:4112078-4112100 AAGATGGCTATTCCAGCTCAAGG No data
1200513596_1200513598 -9 Left 1200513596 Y:4112064-4112086 CCCAAGGGCAGCAGAAGATGGCT No data
Right 1200513598 Y:4112078-4112100 AAGATGGCTATTCCAGCTCAAGG No data
1200513589_1200513598 29 Left 1200513589 Y:4112026-4112048 CCCACAGTCTGAAGGTCCAAGAA No data
Right 1200513598 Y:4112078-4112100 AAGATGGCTATTCCAGCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200513598 Original CRISPR AAGATGGCTATTCCAGCTCA AGG Intergenic
No off target data available for this crispr