ID: 1200516774

View in Genome Browser
Species Human (GRCh38)
Location Y:4152974-4152996
Sequence TGGAGTTCATCCGAGCTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200516771_1200516774 -3 Left 1200516771 Y:4152954-4152976 CCAGCAGAAAGGGGAAGGGTTGG No data
Right 1200516774 Y:4152974-4152996 TGGAGTTCATCCGAGCTGGTAGG No data
1200516764_1200516774 9 Left 1200516764 Y:4152942-4152964 CCCAGCAATGTGCCAGCAGAAAG No data
Right 1200516774 Y:4152974-4152996 TGGAGTTCATCCGAGCTGGTAGG No data
1200516763_1200516774 24 Left 1200516763 Y:4152927-4152949 CCGATTAGTGTCTGTCCCAGCAA No data
Right 1200516774 Y:4152974-4152996 TGGAGTTCATCCGAGCTGGTAGG No data
1200516765_1200516774 8 Left 1200516765 Y:4152943-4152965 CCAGCAATGTGCCAGCAGAAAGG No data
Right 1200516774 Y:4152974-4152996 TGGAGTTCATCCGAGCTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200516774 Original CRISPR TGGAGTTCATCCGAGCTGGT AGG Intergenic
No off target data available for this crispr