ID: 1200518187

View in Genome Browser
Species Human (GRCh38)
Location Y:4175502-4175524
Sequence GGAGTCAGTTTGTATCATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200518187_1200518191 27 Left 1200518187 Y:4175502-4175524 CCATTATGATACAAACTGACTCC No data
Right 1200518191 Y:4175552-4175574 CACTGACTCCTATTCACTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200518187 Original CRISPR GGAGTCAGTTTGTATCATAA TGG (reversed) Intergenic
No off target data available for this crispr