ID: 1200518188

View in Genome Browser
Species Human (GRCh38)
Location Y:4175523-4175545
Sequence ATTGTGAAGAACATGGATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200518188_1200518192 10 Left 1200518188 Y:4175523-4175545 CCACCATCCATGTTCTTCACAAT No data
Right 1200518192 Y:4175556-4175578 GACTCCTATTCACTGTAGGCAGG No data
1200518188_1200518191 6 Left 1200518188 Y:4175523-4175545 CCACCATCCATGTTCTTCACAAT No data
Right 1200518191 Y:4175552-4175574 CACTGACTCCTATTCACTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200518188 Original CRISPR ATTGTGAAGAACATGGATGG TGG (reversed) Intergenic
No off target data available for this crispr