ID: 1200518191

View in Genome Browser
Species Human (GRCh38)
Location Y:4175552-4175574
Sequence CACTGACTCCTATTCACTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200518188_1200518191 6 Left 1200518188 Y:4175523-4175545 CCACCATCCATGTTCTTCACAAT No data
Right 1200518191 Y:4175552-4175574 CACTGACTCCTATTCACTGTAGG No data
1200518190_1200518191 -1 Left 1200518190 Y:4175530-4175552 CCATGTTCTTCACAATTTATCTC No data
Right 1200518191 Y:4175552-4175574 CACTGACTCCTATTCACTGTAGG No data
1200518187_1200518191 27 Left 1200518187 Y:4175502-4175524 CCATTATGATACAAACTGACTCC No data
Right 1200518191 Y:4175552-4175574 CACTGACTCCTATTCACTGTAGG No data
1200518189_1200518191 3 Left 1200518189 Y:4175526-4175548 CCATCCATGTTCTTCACAATTTA No data
Right 1200518191 Y:4175552-4175574 CACTGACTCCTATTCACTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200518191 Original CRISPR CACTGACTCCTATTCACTGT AGG Intergenic
No off target data available for this crispr