ID: 1200518192

View in Genome Browser
Species Human (GRCh38)
Location Y:4175556-4175578
Sequence GACTCCTATTCACTGTAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200518190_1200518192 3 Left 1200518190 Y:4175530-4175552 CCATGTTCTTCACAATTTATCTC No data
Right 1200518192 Y:4175556-4175578 GACTCCTATTCACTGTAGGCAGG No data
1200518189_1200518192 7 Left 1200518189 Y:4175526-4175548 CCATCCATGTTCTTCACAATTTA No data
Right 1200518192 Y:4175556-4175578 GACTCCTATTCACTGTAGGCAGG No data
1200518188_1200518192 10 Left 1200518188 Y:4175523-4175545 CCACCATCCATGTTCTTCACAAT No data
Right 1200518192 Y:4175556-4175578 GACTCCTATTCACTGTAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200518192 Original CRISPR GACTCCTATTCACTGTAGGC AGG Intergenic
No off target data available for this crispr