ID: 1200521268

View in Genome Browser
Species Human (GRCh38)
Location Y:4211998-4212020
Sequence AGTTATCTGCAGAAGATTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200521268_1200521271 15 Left 1200521268 Y:4211998-4212020 CCTGAAATCTTCTGCAGATAACT No data
Right 1200521271 Y:4212036-4212058 GACAGCTCTTGGCCTGTTACTGG 0: 162
1: 189
2: 129
3: 114
4: 178
1200521268_1200521273 22 Left 1200521268 Y:4211998-4212020 CCTGAAATCTTCTGCAGATAACT No data
Right 1200521273 Y:4212043-4212065 CTTGGCCTGTTACTGGGCTTTGG 0: 169
1: 171
2: 103
3: 76
4: 232
1200521268_1200521272 16 Left 1200521268 Y:4211998-4212020 CCTGAAATCTTCTGCAGATAACT No data
Right 1200521272 Y:4212037-4212059 ACAGCTCTTGGCCTGTTACTGGG 0: 174
1: 194
2: 145
3: 123
4: 215
1200521268_1200521274 25 Left 1200521268 Y:4211998-4212020 CCTGAAATCTTCTGCAGATAACT No data
Right 1200521274 Y:4212046-4212068 GGCCTGTTACTGGGCTTTGGTGG 0: 144
1: 161
2: 86
3: 68
4: 218
1200521268_1200521269 4 Left 1200521268 Y:4211998-4212020 CCTGAAATCTTCTGCAGATAACT No data
Right 1200521269 Y:4212025-4212047 TCCTTTTGAGAGACAGCTCTTGG 0: 181
1: 197
2: 163
3: 130
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200521268 Original CRISPR AGTTATCTGCAGAAGATTTC AGG (reversed) Intergenic
No off target data available for this crispr