ID: 1200525854

View in Genome Browser
Species Human (GRCh38)
Location Y:4274332-4274354
Sequence CTGTAGGAATGGTTTGTATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200525854_1200525864 -4 Left 1200525854 Y:4274332-4274354 CCCAATACAAACCATTCCTACAG No data
Right 1200525864 Y:4274351-4274373 ACAGCACAGGGGGAGGTCGTGGG No data
1200525854_1200525863 -5 Left 1200525854 Y:4274332-4274354 CCCAATACAAACCATTCCTACAG No data
Right 1200525863 Y:4274350-4274372 TACAGCACAGGGGGAGGTCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200525854 Original CRISPR CTGTAGGAATGGTTTGTATT GGG (reversed) Intergenic
No off target data available for this crispr