ID: 1200526136

View in Genome Browser
Species Human (GRCh38)
Location Y:4277141-4277163
Sequence GGCTGAACACCCTGAGGACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200526132_1200526136 -6 Left 1200526132 Y:4277124-4277146 CCTGCCACCAGATAACTGGCTGA No data
Right 1200526136 Y:4277141-4277163 GGCTGAACACCCTGAGGACTAGG No data
1200526126_1200526136 29 Left 1200526126 Y:4277089-4277111 CCCTTTCCATAATGGAAGAGGCC No data
Right 1200526136 Y:4277141-4277163 GGCTGAACACCCTGAGGACTAGG No data
1200526128_1200526136 23 Left 1200526128 Y:4277095-4277117 CCATAATGGAAGAGGCCCAGTAT No data
Right 1200526136 Y:4277141-4277163 GGCTGAACACCCTGAGGACTAGG No data
1200526133_1200526136 -10 Left 1200526133 Y:4277128-4277150 CCACCAGATAACTGGCTGAACAC No data
Right 1200526136 Y:4277141-4277163 GGCTGAACACCCTGAGGACTAGG No data
1200526127_1200526136 28 Left 1200526127 Y:4277090-4277112 CCTTTCCATAATGGAAGAGGCCC No data
Right 1200526136 Y:4277141-4277163 GGCTGAACACCCTGAGGACTAGG No data
1200526129_1200526136 8 Left 1200526129 Y:4277110-4277132 CCCAGTATAATCAACCTGCCACC 0: 4
1: 7
2: 12
3: 22
4: 121
Right 1200526136 Y:4277141-4277163 GGCTGAACACCCTGAGGACTAGG No data
1200526130_1200526136 7 Left 1200526130 Y:4277111-4277133 CCAGTATAATCAACCTGCCACCA 0: 29
1: 188
2: 212
3: 205
4: 280
Right 1200526136 Y:4277141-4277163 GGCTGAACACCCTGAGGACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200526136 Original CRISPR GGCTGAACACCCTGAGGACT AGG Intergenic
No off target data available for this crispr