ID: 1200534459

View in Genome Browser
Species Human (GRCh38)
Location Y:4377409-4377431
Sequence ATGGAGTTCTTCAAGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200534459_1200534465 16 Left 1200534459 Y:4377409-4377431 CCCTCTTCCTTGAAGAACTCCAT No data
Right 1200534465 Y:4377448-4377470 CATTTAAGAAAGTTAAAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200534459 Original CRISPR ATGGAGTTCTTCAAGGAAGA GGG (reversed) Intergenic
No off target data available for this crispr