ID: 1200535340

View in Genome Browser
Species Human (GRCh38)
Location Y:4390249-4390271
Sequence TATGTAGAACCTCCCAAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200535340_1200535344 -1 Left 1200535340 Y:4390249-4390271 CCCCATTTGGGAGGTTCTACATA No data
Right 1200535344 Y:4390271-4390293 AATGAGGAAAAATGAGATCGAGG No data
1200535340_1200535345 21 Left 1200535340 Y:4390249-4390271 CCCCATTTGGGAGGTTCTACATA No data
Right 1200535345 Y:4390293-4390315 GAAAGATTAAGTAAACAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200535340 Original CRISPR TATGTAGAACCTCCCAAATG GGG (reversed) Intergenic
No off target data available for this crispr